Monday, June 13, 2022
HomeMathNew in 13: Molecules & Biomolecular Sequences

New in 13: Molecules & Biomolecular Sequences


Two years in the past we launched Model 12.0 of the Wolfram Language. Listed here are the updates in molecules and biomolecular sequences since then, together with the most recent options in 13.0. The contents of this put up are compiled from Stephen Wolfram’s Launch Bulletins for 12.1, 12.2, 12.3 and 13.0.

 

What Is That Molecule? Advances in Chemical Computation (March 2020)

You’ve gotten a picture of a molecular construction diagram, say from a paper. However how are you going to get the molecule it represents in a computable type? Effectively, with Model 12.1 all you want do is use MoleculeRecognize:

MoleculeRecognize
&#10005

MoleculeRecognize[CloudGet["https://wolfr.am/L9rL9B2K"]]

It’s the analog of TextRecognize, however for molecules. And what it produces is a Wolfram Language symbolic illustration of the molecule. So, for instance, you may then generate a 3D construction:

mol = MoleculeRecognize
&#10005

mol = MoleculeRecognize[CloudGet["https://wolfr.am/L9rL9B2K"]];

MoleculePlot3D
&#10005

MoleculePlot3D[mol]

Or you may compute the distribution of torsion angles of the construction:

Histogram
&#10005

Histogram[MoleculeValue[mol, "TorsionAngle"], 360]

It’s also possible to hook up with the world of exterior identifiers:

MoleculeValue
&#10005

MoleculeValue[mol, "PubChemCompoundID"]

However what’s actually helpful about MoleculeRecognize is that it may be used programmatically. Take all the photographs of chemical substances from a paper, “molecule OCR” them—then do issues like test whether or not the molecules are equal, or make a phrase cloud of their 3D buildings:

WordCloud
&#10005

WordCloud[
 MoleculePlot3D /@ DeleteDuplicates[MoleculeRecognize[{!(*
GraphicsBox[
TagBox[RasterBox[CompressedData["
1:eJzt3Qm4VVX5BvBSTGwSM8vUTEzTUjOHDNEyVDSaQ8kUS0HAqBwCC9RSaZJM
Tc1GrTSFQrFBDQQtpcxyaLCyOacsxyybbF5/f+v/LJ7t6XI498K5Z59zv/d5
Tsa955y799rrXd/7DetbIycfNX7aGo95zGNmDn/kf8ZPmjVmxoxJx+434pF/
TDhy5vTDj5w6ZdyRx0w9fOqMUZPXfOSH8x953fvIa9gjrxQIBAKBQCAQCAQC
gUAgEAgEAoFAIBAIBAKBQCAQCAQCgUAgEAgEAoFAIBAIBAKBQCAQCAQCgUAg
EAi0gH//+9/pb3/7W/rNb36Tbrnllvy69dZb00MPPZT+85//dPryAoEhCxy8
6aab0oIFC9LZZ5+dZs2alSZPnpxfRx99dDrzzDPTV77ylfTTn/40Pfzww52+
3EBgSOHOO+9M5513XjrggAPSNttskzbccMO07rrrpic+8Yn59eQnPzltvPHG
aeedd07Tp09PixYtSg8++GCnLzsQGBK4//7701lnnZVe8IIXZD4OGzYsbbLJ
JmnXXXdN48aNS/vuu2964QtfmJ7+9Kenxz3ucWm99dZLY8eOTQsXLkx//vOf
O335gUBPg9950UUXZT6utdZa2Xbutttuac6cOenLX/5y+s53vpO+9a1vZT4e
f/zxaaeddkrDhw9P66yzTnrVq16VvvnNb4aPGgi0ET/4wQ/SG97whsw7NvS1
r31t5uY999yT+fvPf/4z/eMf/0h//etf0913350uuOCC9JKXvCStvfbamc94
e++993b6NgKBnoT47TnnnJM233zzpO3wqFGjluvX//73v//zfj/74x//mD75
yU+mrbfeOj32sY9No0ePTkuXLu3A1QcCvY8//OEPaebMmdmGsov+/+9+97um
n8HTX//61+nQQw/Nvilbesopp2Q7GwgEVi9+9rOfpQkTJmR7KGZ77rnnZtu6
MtC/c+fOTeuvv37+7BFHHJF++9vfDsIVBwJDC1dffXXaY489luvcJUuWtPzZ
888/P2255Zb5s/I1P/7xj9t4pYHA0MTixYszN/Hsla98Zbrhhhta/qxaBjFe
nx0zZkxatmxZG680EBia+PrXv77cju65557pG9/4RsufvfDCC3PcqPD7xhtv
bOOVBgJDE3KfL3vZyzLP1BZ98YtfbOlzfNYPfvCD6SlPeUr+7GGHHZZuu+22
9l5sIDAEIT570EEH5bjPBhtskE4//fT0l7/8ZaWfU2s/bdq0HAsW2z3uuOOi
LjAQaAPkQU866aQ0YsSIXP83fvz4rFmb1Q2pZ1CXtOOOO2Zub7HFFmnevHlR
axQItAFynVdddVWO+ay55pppo402SrNnz877WuRXGuFn3/72t3Mct9T1vulN
b8rvDwQC7QGNeuqpp6bNNtss85RdPOqoo9Jll12WfvKTn6Tbb789v26++eZ0
8cUXp4MPPjjrYjaUDzt//vz097//vdO3EQj0LGhUXMRL+9HYRhx88YtfnKZM
mZJmzJiRX2984xvTDjvskOuKcHnkyJHpfe97X/ZNA4FAe0HD2tt97LHH5j0v
9qA9/vGPX75v1OsJT3hC/pl6pL333jt96EMfynVKrdQlBQKBVYdYEE176aWX
pne/+91p4sSJaa+99sr7RtU5yNGo0WU7+bD2uvzrX//q9GUHAkMKdK/9aPal
/fznP881DmK48qb2kP7qV79KDzzwQPY/+9oXEwgEBgf4R8Piov0seMvO4nBw
MxDoDHCP/bR/BR+rwFWxIT1VgqOBQGdg7/ZnPvOZXOMnFlTFD3/4w+yH+v19
993XoSsMBIY27C3TM0XfsUsuueRRv/vc5z6Xtt122/SKV7wi+6WBQGDwIVa7
++67p2c84xnZXlZxxhln5HyM/KjahkAgMPgQv2UrcfHTn/70o36n1l5dw/bb
b5/3jQYCgcHH5z//+fS85z0vOBoI1BTB0UCg3lAv//znPz84GgjUFGqK9LYO
jgYC9cT3vve9fDZEcDQQqCdwVO+w4GggUE+oTbDnrC+OfuQjH8l50+BoINA5
XHfddWmfffbpk6Mf/ehHcx+V4Ggg0Dk0s6Mf/vCH09Oe9rTg6BCCvcH2O8Ue
4frAOaL6YIc/OnRhH+Itt9ySrrjiivTZz34214A62/1rX/ta7vP68MMP9/k5
e6XkBbyc6RV7o9qD73//+yuM6zrjW6+j4Ghvwt5De5s+9alP5X7m6radd2ld
1oOOvtLvCm/Nk8YezJdffnk+t9b77McI29se6Pv3mte8JvzRIQZ7+Z1X8OY3
vznzUQ8rfc2dQfDMZz4zP3f9l9dbb7201VZb5V6tzhyp9rFy3p7zubzPet5X
39fAqqMZR88888z8c3VIzvgO9Ab01XCOO36K2+MmHr7+9a/P/ef0dH3/+9+f
+1htt912mb94ePjhh+eeykXTOjNa71day9yJfujtQeGo2BDNU/UpSu7lWc96
Vrrgggs6eJWB1Qn7+t/73vdmW7nWWmulXXfdNWsmPunvf//7/HvnSOvtSufK
n+vduskmm2Rf1e+BHaWNn/rUp2a+Rq/I9qBwVJ/O00477VF9re3xtr56NmII
gd6AMwf23XfftMYaa6TnPOc5mV+42cgx/3buyIIFC/J5lvor64WOu4C/tK7+
rrgbWrc9+O53v5v7LAwfPjy95z3veVRc4Atf+ELeW+rV6tlqgXpDzypalj7y
zKdPn55jt81isnfccUf+jPiQ3jneD/Tts5/97LTOOuvk9T042h44H3jcuHFZ
y8i1VPuOnXPOOVnnRsyodyBfMnny5GwTxRo+8YlP/E+vuUawp3fffXeO7erj
WrQW34g/6nwR/mucLdIelNyLeLvnZS0sOWz6VsxvqHDUXPzTn/6UtUSv+lY/
+tGP0qtf/ep8fqweOPInrUA8yJyojkuJGfku9jU42h4Uf/RJT3pSOuaYY7Km
FSvS28i/h4IdNe/uuuuu9NWvfjVrCb7V0qVLs+3oNa6WvYh45QwCvulAUWJG
bPIHPvCB4GibUDgqfsDv3GWXXXK8j58hTyYu35+zvrsNDz30UFq2bFk+R8Pc
de9eaq9OPPHEdM011+T39ArUEonj4qg4BF9noNALS17OHNH7dWWaOdB/0C7O
eXnRi16Un5k4vDyYWN+mm26ax97P+S3msHNhesWuiFdan+g12k+Ob/3118+a
wVk3eOq+5R34AHwCOrjb4Z75Np7r2LFjW+7JarxoDf3Si70sHGVHTz755LCj
qxHqM53rYozlrdWS4KN8tbz2xz72sXw+2v7775/9jbXXXjvb2JkzZ2bN61l1
K1f523IH4mFqZ7beeut8/+5djv7888/PuYZ3vOMdee3CU+856KCD0sc//vGc
Q1xR/Wo3wJlaYkb98Uf5onq8qm/ARTyHonXFG/lHUQu46sArz0ht5Vve8pa0
44475tovZ4rut99+2QcVt2Mv5Knt/xZzf/nLX579UnUOdNIJJ5yQ9aGcWrfU
lsgtuCf+2BFHHJF5RzOIiekBbr7p0y9eZA2Tb1i4cGHOTbAVxom+ML/9XHy0
G9cpPLLW8m3ECe1taqzDbYQ12Zh5v7P0Cq9LzIjmUuMSNfUDBx7h5pVXXplz
oM4BNufUJtA9eHj99ddnv6s679gc56Xho7oU2khezVmkNKDYivyqOV1nqJlR
m+p6S88JtTEvfelLs11wD433bszc1y9+8Ys8FydMmJDno1oP8/S4447L42md
qjM8Pz61dUUdH47iJW2Pp2IRxmZF6w39Om/evOwD8IXoLnWEUDhqLtEY3bhm
1QFsov1nOGZ/Ao6xH3yu448/PvPPc1xR/tna6Dnh+JIlS/LZ3mpO+G5skHO+
6Ub6sW45bLwr3Bw/fnzWC+5/9OjR+T7YA3uqml23eYeH1jB8Vp9TalTtjfcz
HHBuVZ3m6IMPPpiuvfbadMopp+T4rectl+ZZuhfc5N/QRm9729uyfm28frpj
8eLFuXbBOdF0Ld+8+OWFo7gecd3+Aa/4+DfeeGM6++yz8/MQAzHOYrUHHnhg
7qtLz7V6pqj38MPUmNA11lP61xqqXtBz9jxpwE77Ja6TzTCfcNM8klsSq546
dWr60pe+lONf8sBVre7cKfdgbOzZKn6ne8djv8dH+fqy3nnhAK5aDzqtKfBM
rIF/SCPRoXSD67UmeTa0rbHx3MR76CLjwg/Ha/Ex67q9LNYka7p6v2nTpvVZ
Ux/50f7BM+BXqQGhz6x99JlnJX5pXb3pppvycxqIL1lqOMUD586dmzngu9kV
53+LKyxatCjblcH2Vc2d2267LV144YV5PskZmVuuj7/NnrIXjdwskCv0Pr6q
/ZT0obMdi30pmsK9yWEcffTR+W/YF2Lts26Z+7SgvzGYcD80gbyuPZ/4Z116
7nOfm2MP9i2JyZb7+OUvf5l5xddWy4eH9Cxei4/Jy9BJ6gVx3LiIG1U1R3C0
/6BH5eHZNPOM3WQ/aRXctM7zzVaHJpULowH1QxJD4tvxb8UV5BbZGjwejHxF
OUNVPMgaUWI87Lxr4YNbl2jfZjZezBbvcNrnxcf4nY050qIpxNf4YcbXZ3BV
jbl4sf0IbPVgrFN0rb2dc+bMyeuk9dLa/LrXvS7vZ7FmN65LxoGOEsd2vc7N
479Y07xwlm+wxx57pFmzZmWfqPFZOqfLvYt/+55O6yfgc8lXuDbj3wzWXu8X
Q5X/L3XIfcH43XnnnTmOygbRWmyBz5rnxrLZusxv4GPII48ZMybHQ4yzNV4O
wXfgUztyzL7T9RkT/i1Nhav0kznCnpsj7cpvGxe61BpEl/nb5po1w5xlV8Ql
W1mX2AHxI5/Tk8B6w4awLbiojq76HDxj/GB/rQP+Jv+O/WKT8LvEv9sBupou
pUldozG3tqhDcQ/mRF/7WQpwlp4yT8038V58nThxYo5niyXS/rSJNanRJ6Ix
6AnzlF3udFzXM7bn2RqNByurjbPuukfrkzHDu0YYO/dmDVJ3x0/cbbfdsg20
HnvO9Kmx8x7vra5Vxris5cXvYjvlCIy1fQniku2u/3Ad5m7RWu985ztzjMJ8
pbXkXK1tnunqeo7GztrAh5IPocusS3J+Rx55ZH4+fGNzqz+2zHPGadrwrW99
a75++T/PxJ5ne4Gsp+U5uB/j6zPWV7Eoz9s6gTM0o/UDX1aXpvC3zQV7w+wV
87xdo7lprM01NsS9tDLexhJXPT/fa864R5qr2fj5nN/XpUeZa5k9e/byfhLq
Opvpb/fLJxo2bNjyvZnV+3B/Yjr4J39OW1h/6SVzmy3EN/82/t7jvWq3ik2g
bT1/ZyqZn7QdTltXnf3bmE9oN4oGtO6ay3w688d47bzzzlmHsre33nrrgPV2
8bus3+yUtUANAm3HZxK79P1szEB1ZjXvImZt7eTfFRtFm7AvVZ/bf0tMzRk6
+E0DiinxVa2h5gx/gz8/0OvyzN07n1NdiblhbVZvgrOueaB7Ajw/f8NnuyXv
XYX7tkaKM/e117IR1vBJkyZlf1qdDu1R3m8sPEvfx1/EYxyVt7QOnnTSSblW
1HMWM6S35Kb4GXLJtInvYJesG+wtncUvpLvom06ua2WOWyesF3IU1p1SA8G/
ETfs71y1XtOifF1+prGjR/lM4lfWPLp/dc2vEh8TA6Kh7OHzDKwJ/r5aLPax
eh8+U/iNqyV2xa7S4bhK/xub/sSVSl2xecefcB38RfUlYsrWbna6TvmfwUaV
o/gkD9zMFlQ5il98tdJjwliqt7M2+z7xBrFvNoZ+4+N4+Y6rr7462095A3Fy
9sJ88V3suFiB9bP4DXRXp/2CAuuE6xQPpH/x0/zGLTFndU3yBCvT4u6TL+g+
5WPZDc/A9xkb4yZm1Kq2G8h9eB56WYopqc+ic1xHieX25aviKl+ZLyJWSufQ
O3Sz5y1OYW9NszVF7prtlUOjm3GTPVdHYd33/NnWuuWmOwHjSFvhiTVxZfWJ
VY4Wu1ueofVezpL99F1sY185gRLrN4/ZHnPb37d2ymOV31vH6ay6rqGukb8m
l0En8JvMcf+lFfiO9GvjXDW+xlHdf7FHPsf3NOf5orSEcWv3ulTGmr82f/78
nM+gX0p+uNQIWiuq1+Ie+HWeuZgeXwRXrVV0E57hPt1chXWLXqJD2F73TNeW
Hn18Tj5jndbkOuBd73pX5oi1UF1FM61S5aj3s7vV3C/b6Xdi5XIGzfjudzQe
f4tNLnWWnc6X9wclhmi9KbEOcTFrlLlqX43aOnPVOKkXwE1ano7HTVqZbhaL
Mx70yGD7TUX/lphN2XfgmYj38VPoBratXFupgSg2US6RBsBv6265J3F99tp3
l1phNldMgn7iF7PJtHcn7r0bUDiqN4S1jH9Ay/T1Mr/kAvDQGNOn4PnSzGwo
+2oOmo8rgzXcumCu0sfskXW021B6HRgjcTTzU/yz1MLwK8WA+Vilrtj8F38x
buIlddB25T74/65VLbN7KLUceIiP1ZhFiQHTt3TulClTsi22ThUOsqu4Wfbc
WMvFJPi+8iwry/EOdRSO4h0bQIPwj/p64afn1chRPiMb4udifmxqq2MuVkrv
+SytzJZ0K9wzm8nmWKdKfFZchQYWCzVu/HDxYfEX8dq+8nSdBM5ZM8QD3v72
t+f7KPEhvmqJtVZ9btdPg4kb8ckPOeSQ5XvkvMT3vdhadpktsI4HN1eOKkfZ
QbmRUpfR+GIjy3urHC19+Pxc7rQ/PUjEj8Qwfdbzk4vsZhQfT5zM3gp7xNhU
Y8uG8N3U79F2dH1d/e2Sc7KGuA8+jrwqzcNO8l0b6woB59hF9pH9lKfybK3t
NLQ1mR/fak31UIc5UvbdGUd+Pz+JPqPXzCf1GWIH7Cudxtdo5KhYPe3i5/QM
7dYqcNTf9Fl7T1rtF1V38KvoRmOhPsT9yXP4tzxSp3Vtqyj6V/xPrJcd5auy
jZ51qWWmdaucc39yUfRy6Y/g3sPn7B+sd/LGOMo+4qOYP62GO7in5q3U9Ik5
mmeNHFUTisN+bt30vlbBh2F7fdba4Ln2EuQv1H+6PzXH4m5lLpc4Ersy2PXq
/UXJOclZso9iSSXmRQfZJyhnIj5UoJ5YvN69izXQFoH+QUyOLy9eRIvxofhT
dIiXtdA6ai55RvxOcaVGjppjasr83HPz81b2C1T35vqsNcKa0Euorl98u2os
TW6GbTLuq9LLbjBR6grthZM7klel4fna4glsatEIVY6ytyWXHmgd6mLl5Iwh
nsrJy3utCNXcS5Wj/Bb1DPYDyaPQxmIKrfx93FaLyNf1HK0bvYRmHLW/Rg8F
65q9HN2Cas2VvCp9oHZTzFEepcR9qxw1P3qhv9lgQ17vgAMOyGPopWZzIBxl
Z0s/Nb+Tk2Yfmn0Xne15ikNYH9Tu+o5ei/M142jpC8vXkIfoNpS91bSPGjP5
GnqgaCg+bOlNHRwdGMTk2DEcWRWOAl/DPhcxenaRj2KPCl+2GvcrPfz1PRAr
UverPt++DjHEXkMzjqrFEYczBmK93Yqyn00srBqv5YvTv8HRgaOck7E6OOo5
iffIwRTtKk6Lt/YG81+87EfzvORZijZWyy3m14v9hlvhqJoGOeVuRl95lGpO
Ljg6MLBb4jSlRl7tWrNxZP/UkeC0PKpar6qNLGfGif2yp76znJlsH5eXuG+x
tX6nfsXeq17zQwta4ahx4Bv0GsIfXXXghZi5ehC1JPatN8vb4aAaapyTL2ns
JWEtZYflbtTqy7GWvZb0HF7ip5/RuXKz+qCYt72aM2uFo/REVZP0CvTyUo8d
HB04yvnk9v7xD1d2ZqP3qx+hy9SDiTk1vr/U2bC5cqzsg+cjxyNHpq7Jz2hb
uZwV9crqFbTCUXkvdb69Br5RydUFRwcOdrOcfddKTJXP6P1sarP3F656L3uN
s/KB/r+f9bffR7eiFY7SFtbJXoO9LiVvEBytP3B2KNZntsJR9ZV0Sa+BRiu5
F/t7GveTBgJ1QCscFQPvVX9UHb17l1ujpQKBuqEVjtqzpW9Ir0HPhXLvelPw
TwOBuqEVjtpHIqbea6jmR8OOBuqKVjhq77Q6j16DvVLqkaOmPlBnDOX8qD0T
Ja6rB11o3UAd0QpHu7WmfmVQD67HjnvHVftkAoG6oRWOqq3Um7/XwI7qFRMc
DdQZrXDUvp9u2j/aKqo9KPQ/YlcDgbqhFY7qYdCLMaNqXDdiRoG6ohWO6sPg
nKRew+rY9yLO5FXX/omB7kcrHNUX1TkevYZV5aheHdYuZ7M1O+s2EFgVtNqH
Qe+1XsOqclR9rx4Bzgq2hyoQaAeG8t40cVznng+Uo/ZN6acudxwx4UC70ApH
9Z3pxXrdan50IBy1T4reda5F3fsPB7oXQ7lXCm7pl7UqMaOyp3Eo7msMDA7s
/Sj9QlbEUedY9eL+UXGeUsOgd3O1h30gUBfoReCMlGYcdY6a83F7DdWaej0n
9fYMBOqGVjjqzBS9iHsNzmMtfRj0oONbBgJ1QytaV8yoW/Oj+mBde+21WQeI
vVZrDXC09MAOrRuoK5rFjJyJ7dxlZ0p24x5v+UvnibKV2267bd4XUNWz1VpA
5/Pdc889HbzaQKBvNOOo3IS+48400p+rW8BWspE4OXr06Fwnte666+a+rGK5
BXq7TpgwYfm5jvpCBgJ1QzOO6oMqrqIep5w1VmeU8y0vueSSdNhhh6WRI0fm
vJF+6HonO2NKT9YC7y3n8kWvlEBdUeWoed147hSeetU9/8c+qvmxzji/Gzf1
YTrkkENy/3Q2U51BuQ98doZaOd+dPxpx3UAdYc/G1KlT89k3ztNV8+cswGZn
dtQJzhll6+fOnbu8X7c4tLNAnGXo3AK1CdVYET916dKlmc+bb755PiP+xBNP
zH3TA4G6ARfVJzibVfzWeav6WF522WU5hlLXXv0455znc889Nx144IHLda3z
7uQ6ndNDu1bXGrZTrkl9rViY8731atpmm21WepZQINBJ0LfO0LV/Qw9Ac5cd
mjNnTj4Psk55Q2uGWNall16a+4Q5n1v/34033jjXDC1cuDCfKVs9C8R/77rr
ruyn6rdgHXKu3hZbbJH9UecD8U3rrucDQxfsC/13zTXXZM3n/GR60byXP3Se
uZ7unT5/la6VDxJrpms32GCDHK8Vuz3hhBPSddddl/Vq1fbTucuWLcs1CqNG
jcpn5FmH+KH2fdLCztLrtfPZA72HckYVGyX24hw5NmrEiBH5v9OmTctnKNOP
g91zwLXxke2n1htM7xa9IXCOXbz44ouz7ayuIf6/eFjRBxtuuGHmZ9EH6jPE
mejbsJ+BbgIbJP5pftvrwo6qqWevdt9995xjlMMYDP2LP7fffnu6/PLLl2tU
/c/UD1szaFf+ZdV24pvPzJ8/P+9pcXatdUZs6NBDD83fZZ2xHgU3A90M2k9t
HP1r3xZ+0r98Veegn3XWWbmuoR37JnFH/68rr7wy50SKrt10001zDTyNqqcf
7Vu16XgnnzJr1qy0ww475HWFrlWnIE4k/lvNvwQC3Y6q/hWjUS8nP0Nnbrnl
lvl8XXWw8jera977e2r05ICsBTQqru2yyy7ZVxbD4jtX/Uc8FRO66KKLMh/Z
fbrWter3d/3112efM+K2gV5F0b90JQ1Jd2633XY511G4c8MNN6ySTcUzdQbn
nXdemjhxYq4/kAviC6utsBbccccd/1NPISbE3rKdahfoWlrYZ+bNm5evudOx
rkBgsIBHagJxyT6YffbZJ2tfelIsh/4Vd+1vLQAbt2TJkpyXVfvObuKZ73R+
ON+4MV5rPWAf9UJjb2lh17LnnnvmOt2+ahcCgaEC8159wxVXXJH9Rb5fqb2j
Ndkv9emt1D+Ix4pN7b333lmf4udee+2VuadOmF/aqGvFhNRd2FPnb6otEhti
3xctWpT/dujawFAH/qkToD/Vw4qhbrXVVpljciJymPIbfMdmXBWTYgf5uKX2
ffHixbl2tsoz+vaBBx7I68LMmTPT9ttvn2O84rXqjORY7A+t1i4EAoH/5yr9
q8aB7Rs7dmyufdhoo41ynQDdSZOuSP/Ke6q1ZY/V4/k3nlV9TraUhnZ2GxtL
14oL4fapp56afWEx6KhDCARWjKJ/1arPnj07x29oUHaOX+lMJ/mSxviNf9Om
YsO4XvUfcU5NLhu5//775++iqdUWz5gxI1111VVRhxAI9ANF/6p9XbBgQa6n
pV/xSq5G3YEaJnmSqs3zuSrH/H/7WEu9k5p3Gtp32GvGF2Vvow4hEBgYSvzX
+Z5yKfanqt+T61QLrCaCH9pXrRKbKu4jn6N2QS6FrnXmQ6mvFa8NXRsIrDpw
FZ/0/OKX0qv2muCrGkO1P0X/lvpD78NjfObTqpfnq1brawOBwOoFDorTqtNT
z77TTjtl+4ivkyZNyrnWM844I02ZMiXnUOw1UyPB51THr1d16NpAoL3AL1yV
23TesDpCNfKlDpdtLTVCBx98cPY5xYsaa3IDgUB7UfTvzTffnGO9fFW9QXGT
/pVLiRqhQKDzEPOhf/mqdC6+0sLiueFzBgL1QNG/4rvsZjf0HwwEAoFAIBAI
BAKBQCAQCAQCgUAgEAgEAoFAIBAIBAKBQCAQCAQCgUAgEAgEAoFAIBAIBAKB
QCAQCAQCgUAgEAgEAoFAIBAIBAKBQCAQCAQCgUCg2/F/bm+/Rg==
"], {{0, 166.}, {
           233., 0}}, {0, 255},
ColorFunction->RGBColor,
ImageResolution->72],
BoxForm`ImageTag["Byte", ColorSpace -> "RGB", Interleaving -> True],
Selectable->False],
DefaultBaseStyle->"ImageGraphics",
ImageSize->Computerized,
ImageSizeRaw->{233., 166.},
PlotRange->{{0, 233.}, {0, 166.}}]), !(*
GraphicsBox[
TagBox[RasterBox[CompressedData["
1:eJzt3Qm8pWMdB3BbkrZJlKJEUVKKRqgQ2caEzDSUtZkYkQyzYWYoCQmlkdRM
JaVNG7JFImU3pdFqaZH2sqRN25Pv4/Ncr+OuM/eee973/H+fzzHjzjnnvs/7
Pv/t91+etadMmzB1uWWWWWbGSg/9Z8LkI7aePn3yURPHPPQ/kw6dcdCBhx6w
/7hDZx5w4AHTN5uy/EM/PPuh1zLLLrPMCg/9kQKBQCAQCAQCgUAgEAgEAoFA
IBAIBAKBQCAQCAQCgUAgEAgEAoFAIBAIBAKBQCAQCAQCgUBgCfHf//43Pfjg
g+mf//xnfv373/8e9Of+9a9/pf/85z8jfIUjh//97395DWXt/u5nTYdnZ71/
+ctf0j333JNf9913X/r73/+e/y3QbHjGDzzwQPrNb36TfvKTn6Qbb7wxXXPN
Nfm1ePHidPfdd6d77703y0NvICPec/PNN6c77rgj/eMf/+j39/meP/7xj+mX
v/xl+t3vfjfg+0cSrt0+//3vf5+vfdGiRT1r/973vpd+/vOf52slH00DXX3/
/fen22+/PV133XXpvPPOS2effXZ+ff7zn0/f/OY3837485//3OezD9Qb9v7P
fvazdOGFF6bjjz8+ve1tb0t77LFH2m233fJr8uTJ6Zhjjkmf+tSn0ve///2s
J1pt4t/+9rf873vuuWd617velX7wgx/0+zvJmj02Y8aMNH/+/LzHRgNkms67
6qqr0qmnnpoOPfTQtNdee/WsfZ999kmzZ89OZ555ZpYPdrEp9tBzv/POO9OX
vvSlNHPmzPTGN74xbbXVVukVr3hF2njjjdPmm2+eXv/616e3v/3t6eMf/3h+
pj4TaA48z29/+9tp7ty56XWve11aY4010lOf+tS02mqrpWc+85lplVVWSU95
ylPy38eOHZsOOeSQ9PWvfz37AlUd8Ktf/Sq99a1vTcsvv3xaf/3107nnntvv
7yXv5GzllVdOW265Zf7OdoM9o8/IPVlfe+2105gxY9LTn/70vF5/Wvuqq66a
XvziF2dd8LnPfS79+te/rr0OsHY+3rx589JrXvOavMYnP/nJ6VnPelZ6/vOf
n+/F6quvntfv9fKXvzxNnz4975XQAc2AuP6GG27Icmu/P/7xj8/P33444IAD
0qxZs9KUKVPS1ltvnffDE57whCwTEyZMyL7CX//6157vIs98BuPOnv3sZ2d7
0R9+/OMfp0mTJuX321vnn3/+SC/3UaC7+Pr03jrrrJPXbm2bbLJJ2nvvvbM9
nDp1atphhx2yPiMD5GOLLbZIn/jEJ9If/vCHtl7vcMLa+XtHHHFEft6Pe9zj
st4fN25cOvLII9OHPvSh9IEPfCA/f3rxBS94QVpppZXSM57xjLT//vvnGK/O
HE/gYbDZ9j89b/+/9KUvTYcddlj2B2+99dYcm99yyy1Z1vn0r371q7McPOlJ
T8q28Lvf/W6PDzBU+f/pT3/a83621e9sJ8S8H/3oR9OLXvSitMIKK6TnPve5
6S1veUuOYezvX/ziF9nf5Zd88IMfTDvvvHO2kSuuuGLWh5deeumgedFOA47P
89lggw3Scsstl+Xbc7cme0JMJJ5zD8RF73znO7OOtkfslRNPPDHzIYH6Ar//
hS98IW200UZ5D9gLnis57m1f4/Y++clP5viQvXjOc56TTj/99MwFwFDlH6fG
znr/euutl7mmdoHOwu3ttNNOeS2u9x3veEe66aabeuUhxfyXXHJJmjhxYtZ9
dCDb6J7UEfSbtZBnOm3atGnpRz/6Ua82XZzjWdkb9IS9st1226Wrr766K/Ii
TQXOy57n14nBDzrooMwB9/dMxfwnnXRS9hXF+eRdbgCGKv933XVX2m+//fL7
11133RxXtwtk/H3ve1+Oedh+HNd3vvOdfn1aNpGOYgeXXXbZzI2xl3XjAVzv
woULczxHlrfZZpt05ZVXDrgO8dqb3/zmrC/pDJxJNf4L1AvXX3992nHHHXv8
78985jMD5neK3dx+++2zDPCd+RBQlX8+ovgRx89PlDsSL+PNyou87brrrvn9
fI8vf/nL7Vh2BrstjiX7eM73vve9Odc9EPjDuBIxwNOe9rR0yimn1I4L46+J
+3E5T3ziE3P8Nxhfnv57//vfn3W7Z48XwiEE6gn8/Ete8pIsfzgecf5gQI75
DeyAPAE5Zzer8o8n23333fN+OeOMM9JZZ52VY+h3v/vdPS/+xgtf+ML8fvmm
r33tayO84keA88R1+d3in8H+bnERvwFPyHYefvjhteMB6T75XDIshvNsBuvD
XHTRRemVr3xlvm/uHxsSqCf4gDgvz5I8s9WDAR/huOOOy3EwOzhnzpzMpVXl
n2yQEbw6H4HPzMfnF5QX+0mHeD/O3d5qFy677LLMZfrdeD1x/2ChZkEc7LPy
l6NVt7CkEOO96U1v6tG7Q7nv6h/E/j5LD+BEAvVEVf7JML53MBAD4ADYfjaE
7lC/V5V/P8eR4QnWWmut9LznPe9Rf3rRAbgH7+eHtNP/r8q/eqWhyDAOQLzk
s7vsskvm0uqEqvzL837jG98Y9GfJv9ivPLOvfvWrI3ilgZFEVf7VvA3W/uPO
5IPEjuy3fLHYuSr/5JqdOPbYY9Npp52W8wTVP73k1+XVRyP+r8r/UGUYr4k7
K7oDL1YnqPdz3a5f/CUOHCyPf/HFF6dNN900f/a1r31t+ta3vjXCVxsYKchz
88k9S3WfhccfCOJHtUG4MzZejC8urso/fhinVmrmSz+N95W+GvUF6ohGo/7H
vpXDH2rs4brFPnwfMY6c+WD1Zqfgt7/9bX5+8jdqHfH4g+m9wPHgcnAG7ptc
gJxhoJ64/PLLs//HVxcH8uUGqmfBE+kHKbIjDpY3gKXJ/6k7+spXvjJsaxsI
rtX+JQOulV8yEI9f6gXVLJB9HCcdN9i4qVNA1vlldDf/7cADD8w+wUA+AL2h
D4Bv53NqgcV9gXpCTYc+H7l/dkCPi/xWXzqA7KsZwN2TGTKAA7722mvzvw9V
/uWO8Gejwf+rf9PnJPdnL7sOPX9qonoD2RDj4Mo33HDDnpwp37lu+X/Q48fv
of9e9rKX5XXJ0fa2lrJ29Rk+w17gcdRARz9gfcGXPeecc7LvzZcng+zgbbfd
1tPz7cXvYzPUAtsnr3rVq7LMkB01wcX/XZr6v8022yzX0rQL9rSaF7X9auDE
8zhQ9czy49Zc1u4+yfGpgVavgPfwkv/+4Q9/2LZrHk6I4axX/RN7vu2222Y/
zjOWy3EPvNR7qQf+4he/mHW9nE+p/dYXHfV/9QYZVAtCXtWD0AG4PT6+2M5L
nK7WE+cvXuAv8B3Vj6oFWtL6/5KHHo38H9jb9B0Okg4Qy/Bvybm6f2v3J/8G
V/qGN7wh5yzJi/uArxzNmQVLA8/MujxDz9Kzp4NxG3wa94A/9tnPfjadcMIJ
Od6j8zx7/U/eE7V/9Qf7pg5v3333zbyO58u3Gz9+fK5z86LrceS4QvuEDLAF
+IJS+w/6eUpeaajyL/4fjVwSnSXuwYPb3/rb9EDrA7J2f+Io+Uil7wn/bRZA
3Xi/VuAt9Fx5tp699Xv2/Dv3QF2wHL9cLa5DH7g+7QULFkTc3yDQ4/hwfoCc
mL3gWeO4PXc6wd/5ivJ0YmVcnZ6YKviOBx98cK778b7CC/YFfJK+E3EEe8rm
tBul/19vi7y2eiW5i7L20uvjGvkH9KKeQT5xEyDmlwuVwxUD0IP6gd0DL8+c
/NMDdDV/IGS/ecD5lTkw+D3PWk+MHL6XWl79bh/5yEdyzacYsRV8ARyR3JLc
fuEF+4L36x0wTwSPLs4YDfCF8Zpy22p71SXz9cva2X81TvJkcia4gCbFvXQg
Llb89eEPfzgdddRRWY974fg9GzVP4v2qvxdoHugB+9uzVhdGJvByZJl95zP2
t/fl+8mxmpiB+ml8j/eLG+QdRjuexPfxacT9/CHr9vJ3P8MX1JHrHwzKzFPP
V1zm+XnRC6WGo0k6L9A/8AL88yLzTYe9/6c//SnrvtYZn+J8suDfmyoD9J41
6sus9kDLh8oH4UHlTAPdAbZOn4s6ETmxpoPNs168nv1eQC/gukteoInzf+m0
K664InMx7kHVb6P/cSPiubr1OQSWHLgAtXk4L3XCTQdOQw+02UbVnjb+gDgY
D0gGmsh90WlyfHhba63ONHIv5AXVR3z6059ubPwTeDTUtegJkOvTt9/0WY/q
Hch+6xxCvXLqhOUo6UP/3zTw9fR/qQFTC8zmF6jxkxORE/jYxz4W8t8lKPIv
3y8GGG1ubqTRl/xXZ5SqBVD/3zTwcdSBqwVuXSOZZ/v1iYoNmsp/BB6NIv/V
/t4moz/7X2qa5DWrtrEpKP2A+jnkfKuzUIr88wPVStZ13nFgaCjyry726KOP
bjz325f8V3sUmir/+jDVf+rrcQ/0RRQU+ecbqA3uqz8q0CzI/+t1wXvhf+ta
5z5Y9CX/pUeRbIiNyUrTQKcV+Vf363yfAvPey6wzvV5NzH8EHgv5IH0e6oDN
fGh63FfmAekF0utWUI3/1SnylZsG9T1qHvF/av71ehWoz1TLHfLfXdAfbi6u
nJCa0KZDP4M+eOfeVfsWukH+cTty/7geOp8vVKCeu8w6DPnvHpQ5zyX/1/S8
j7kGZN9MUjFvQVX+5cbVxzUNdJqzEPB/rfJf4v+Q/+4CDsh8Rz2h73nPe2p3
xsVQoe5vzTXXzH3LdEFBVf6dBdpE/g/HWeYw6fOvzvQM+e9OOBfa2Xh6f/UD
Nr0HwHm3alzs9b78f/LfRP6vKv+eefVMj+IXhfx3F9gAXFC3+P9F/tW5VOud
q/KvB0CfcNNQlX/nwZnxX0AXOr8l5L+7oNfFTC78fzfU/xb5N+Ooeg5xN/B/
eq9LjUNr/G8mEx445L+74Mx7c6DMvhH/N33uQ5H//up/myr/ZQ5bb/yfGYDs
QMh/d8HsDzO51P+o/296/V83y7/6f/l/NX6t8s8XKmfEhvx3D5zFs/HGG+dz
Acr5vk1GkX+xrn7/gm6Qf7rdOca95f+D/+9OmG2tHqbb5B/XbcZlQTfIv95O
sw2c5dwq/2Y46/8N+e8uFPsv/++cnKbn/6v8n5q3gm6Qf/6/3obe/H89v+6J
2mD7IPp/ugN4n7Fjx+b43/zXpuv9bvb/zTLX96//p1X+zfwxE9w8dHmg6P/t
DhT599zL+b5Nhrnm6v+60f+vxv96IK+66qrc7+WF/9P/Iw/kzPam74PAw/Mg
S96X/6/+r+n5P36uPlexrpo3s37lxfTC6oNusvzz7cz8N+tBzRfdbwaQ3mf3
wtlMdIMZgeH/Nxvm3ZpxSdeTB3Ef3/CWW27JNcBNrQO0z8m++n/zjvDezkHU
F4cHbbL8V+d/Was6x8MOOyzfB8/eeVC4QXMgQv6bC36gs7D0+zv3hu9v34uJ
nQ2mR16s2DQugL8zf/783PvnbE/5bnKAD3D+FR+ozP8TDzQpF2LtzmtxxpE1
OvPMup2DWP4k++ZAdoMf2I0gz/pa+fzqQMR7eD97Xz28c+DkgPWGOAP4hhtu
yOfGNUEO5DXotLlz5+ZeBzJgvzvvzywQPhD5x43ph8YT0AEDnYPU6fDs9P2b
8+48Q+ebWrsYAAeiD9BZ0O4Jv4BeNCNIPOSskKb6gd0Ecu9sG/1efDv9vuZ9
qPkX+zvzTsy35557ZllQC0Ae7APxMjlwDmAdOSF+rLXrczbXbvPNN89ybo3y
nnxgcnHyySfnc0HpQvdGLSy/WH2kWKBu/jC5NctNbG/O0YwZM/J5xuTc+ui4
Y445Jl1wwQU5JtIXJP+H/3M2sHMg9UfhB/gCoQfqh3LWlTP9zHR1vrfY1x5Q
/0re7X1nY7Pz3ocPcD4GP4BttGfEBPaQ99WlPoDdY7/MuBXnmHHKxylrN+vf
2p2FRU6sXz0wfeDsa/yA83BxgmIGZ+KYn+Wedjroaf2Lznun162Hb0fnyfU4
79y8f/2A5FpdkF5AZ6I6D5XuZxs8e/4SntBZSeLG0AOdD/4qOXWWJd2u54td
p/f5fP6fTJD36rxvz5YcyAuzlbiBNdZYI8uNHoE5c+bkfmG8YafaQ2tnr+gq
Pa32ujjf/mfXyDMdZ787D6MKPo55yPQAPpAPgCvweWeCLFy4MPMm7lknxkSu
yZrE+Z4vG77eeutluZfbN998wYIFeeZr67nO7ht+0LPXB8YXov/sF7NC1Q2a
FcefqIsN6EaQS7rfXE+5Hvoe12MPkGHcjri+qss9+6peL2eC8g2dF+M7fJ4e
mDRpUvYl2EP2tZNiArbZdTvL2H7l69N5bDldpr/J/h7ofE/xEr+A/ysGwovS
AyVeUDfEHrKbncINkElx2jnnnJO5Hbk8vC6dZ9a/+Oaaa67J+qG/a7YPyhnp
4gP8AN1p/XKGciXmhrqHdfCFugXkkH9Ktp1fv/POO2d5tf/pfr6+elccWJH1
wg3R6eK81t6/Igd8CLUx9pLvYw+nTJmSa8bY2dHmyEqcw66p7xs/fnyO4/n6
+A06jC7DfQ7FfyVT9Jx6ODGR+0kOzA+ePXt2PjNP7cBo+kLWjt8o+p7P7hlZ
vxo/8orD8J6hPCN7w9r4Qp41rtj38glwBfZE8YUiJhhd8Hf5+nLZfHs+n72P
zyH37DW9UGZ7eV72tjNvzH2eNWtW3s/e0xvYOX4/eyA3YA+ID3FI9tzll1+e
7W677QGdx54tXrw496/w9dk914a/4P/yd92bpcll+h38BveIfPl+OTMzdE45
5ZR8brL3tNMXKnGO87rNbRa3q2vkp8lpyvN7tvT90uhm+2TRokU5nsCZ2FP8
Kc+en0E/4BG8r1N8oW6Be158NXWdbJ3nr45DnGtvinOruVxyYLad/ey8H7aM
f2fPmI3dF8i2mZjmheDFS0yAH+Br4MjIQbtiAmvnm/B3zeu19hLjk0u+Pj+1
Nc5dUrCHfCTnZLB/fCo6VmygpwbX4HroypG2h9bONpvdpH5nww03zNciVp84
cWKWVRzAcJ7lws7ji/QGsQF8Ifyw+ABXxP8YbV+oW0AW8XT2t7iO/JW8lTOc
2Sk1PN5TdDKZ9P/0gRzgLrvsku24GJFOF9fy5waCvU0O8Mf2GjtbYgL2V0yA
Qxspv9Ce5mvwR/ge7BC5V78ir6l39dJLL817cSQ4OjGSeyjGYnOtX0xQ7nv5
3SMhB6V+Qy5Tr9a4ceOyrvfadtttM2+npp8OHgnYS9Zmb+FX1BK47/IF9iB7
Y56sfVa1AfYBPYw37u/lc3Rbb/uGDRPD+J5O5F7bAffU+ul28Rd/jM63//H7
JV9PPsv+K5wwmSSzbJccoBw4+beHPTc+3lB8ZM+DDNIl9IDvdB3kUf0s31PN
yXD5hXSedRTZk88r+ktsyhflv1T5jZGC9eBaxNVyInjVUkOFa5NfcD/t5+GI
iTxDz10uk9yTNTLnfstRkEU5Or5gO2Jx68f7yJ/ac/yPUkfl//lC1fpp+oiv
4rn197Kn+RHiiar+pPPpNT4mX3ek9FunouTz+JfirenTp2f/m93h7+K73D9c
VfH17QN/xwnj/cgk/pqfKHbFDc2bNy/bkoH48L7gd5ADtWLsrjmC5IBN8Hfx
hTiDbl9SOaDzPG++Scnn4Tf8Dr43Xo680Ynt9j2tiY5TG8F/IgdkEgfhnA26
2HWT3SW9v/wNz9CcFjE9fa9Gxz2gA8kgfd9u7sV6+Hj2nGtgV8g/DgIH5ecF
7oG5g67dy7V7r+fnJZaiz+xPsYUYA6dT7JG5pfa8z7nP5KBbUPp0Cv/E1vD3
cDD8P/eKPyZ3W0AO2EFn+4jVxfh8dHuTXLqX9qz7Olz2Ajegn5YdLvWk7KF6
c/zUUPPmrsv7+S1iCjE2H7v07tr75F4MRAeNJvfkfuPhXA9fSH0RXoSOdj/U
W/Ob2bHBXKf3FJ5Gzl3tntjGcycnYjf12dbOxxhtsDO4Af3jcgVsAc61wN5V
g6TuWH2xNeBR3R8vcu9n9qj+Q74k28THsA/kdfhVPm/tVd3SVJR4XT8ePoed
I/N0P65OzS75FhMVGfYnH5mfyKenH+xDPB09SwezoXj/kbCVfBRyoE5GbELH
8wtdL/9jsHlz/86meb/cHbnnV1h/O+LcJYF771nwheQg8a/uvetWe6C2TrzE
R+/v3pf6Dbl6Mq72xrp9l/x74drYhE7i20v+max6xlXusSr/dBg7xo/ll5o7
YE/Snc5d5wvQAWw9rtX3dJP8e6b2P7snHnIWDfmRc7IH7Cu9Kf697KPyGTLD
BpNz95GuoEvF+HhC3Iz3jTQKVyxv7neL0127mEMtcV9581Krz5/xvhJXi3PM
q+C3iPHbFecuKfj7cqJ8L9fND+IT8A3YSM9BzFXlyEq9sr0tX0t/eobiHDG+
ekRrd986ee29oSr/8jS4CrAOL2svPansGj9VPzpeg19blX/ch7pm+0TdClvm
hTOoe01S0f32P5+PH+3545h32GGHzDXZV+SrzG1hc/mJeGd8OFvJ5vKT5WbU
+7GVVT+hHXBt9rNn77o9f3JMD5S8uXoD12UN1lTyzHQGm8cftF/EvcV3qEvt
qX1oT5JZuVk+bpWnVa9Ah7tHfDa+rjiH/1zqldlAPRvsYOlTqCOq8m9P81t7
gz2DM7Fu76UDxRH0ArvvZ+IgewQXSFfgg7zkQfmd7mPddIB1F7/dDF66jpzY
A4Wnw5+Kscva/ElXkG3+MP1AZvgJ4n32s8Sdowk6B8+AbyDH7KBrJAdqk/jK
/FnyXepW6S+2r/To4PbqIvet8JzoLRwILqTEufSaPavGmP/L1rHznjndTUfq
3ZHvaIfPNpIYjPwXW8a3dY/0YbtfbD89Kf71efcGhyX3yC6SE/sJ3+Rn8iN1
O7uR7SOr5k6UuhI5LXqNP8+OFLkvfiJbWepSSx7MZ3Gv9lP1M50Atosep9/0
EJR6UvoA51t4TWuRzxAvt/Yn1RUlXyj+54/R6fw6e5nMy5kWf4f/ph6TjMj1
d1J/xZKiKv/0u5otfn158QHZCHaAb4Svkp/mA7NfOCU+oc+X2SX2i3+XY/KZ
whu4n2q961QjQMfjs8XrbB/dL59Hxovut4fU78oFsRl0AxtK7skN/8hn9Ph3
6uyW0mMmfsP34LbKzB3P3B7h66gxbHe80g5Yj7wMzkvNoj3MhsnH8vlL/YZ4
tpN099KiKv/4HLlRfl958eX1GdvD7oW5LOQYRygmrsb/ZpSIa90nuVc6Emci
FqA/7Sc+QJ3OsbYWOS16TY8m3Y/fLfufX1Rqb/n1VT8RH05m8AL4jzrIDD3g
WsVrcuaeK59OfZJ1NsHm9Qd7k08rp8/Hx9uceeaZOf7rVN29NKjKP/nl69B3
fAEvvqCfmT3GnomN8NUldq3KP19fzrs191PmF3uP+zlcdd/tADlgw9lzHFCV
17dOfqOcqhi/xDt6W+VRcKninU6WGb6Yfe1V9cs818LryP2Q/W6CZ8Yf8vzc
m07K5w0nqvLPttvrclo40epLHKTPlC4Uv5b7UZV/ekOs3Hqv/A5xVR3lnw/E
L+IPqiktoAf4Au4JuV955ZWzn8BHKP5PJ8t9gT0up8FHEQcXsIFyYp4ZLqz6
b4HmoCr/7LxaEBwAm1198fdxPq01TVX55++KH/v7HXzk1tkunQxcV+E0qvLP
T1QDghMTF5V8nhqTuug3elqOAi+J38R1FIT8dweqssnus99DiVMHU/9TzrH3
Hryg+LIuIOO9yT/7717Jm+GExYv4ozrY/AL+Pn+Oz9d65nbIf3dgsPn/vjAY
+Rcjqw3wHrnUTqiLHizIvzncrfJf8kby32qd6lj/Qc+reZPXUIOsL7Ag5L87
0A7518dWfkfd4n+5MLkLnB4/pmlg//EXrWdu0mulriPkv7loh/yXc+zrKP/s
o5ofHKjahaahyL/8hjrAgir/H/LfXLRD/tW8sS91lH91O0X+S29Ek6CGV62C
XD8+o8C8MP0cnpk+PzU/geYBX60XFceFw67GuIOBHgC14urj1ITriW0FuRE/
e4/Zb62zbDsZJf+nbl+OrGkwl9Scklb51/+j1pH8q/3XzxBoHtSsql9Rw2se
8VDnd/ALyxku+sZ6qxPR9+O7vQfHVCeurPj/TY3/9b7w/1vlH2ejP5b8m+vS
xDN3Aw/Pc1DDLw9M9ofay4UH1x8g70+X9CbbZVY9X6MdM+CGE/r3zEXRv2Te
S9PAv1G/0Cr/agHUNEb8H+hmFPnHj1X58aZAXb8+l1b5j/xfIPCI/Jt7YCZS
06BWWU93q/wH/x8IPCL/epjVQTcNJf/XKv/iwVKzFfIf6FYU+ZcbbWL+z5wS
8y5a5V/NpnxQyH+gm1Hkv7X+tymQu+mN/zMPqMx1CfkPdCuaLv9mXfaW/w/+
LxBovvz3Vf8T8h8IpDzPyOyjpsp/X/xfyH8gkHJNo7lnTZV/9X/mvoT8BwKP
BfnAjzVV/vvi/0P+A4GH/WP20ex35/g0DSH/gUDfcCaG+R9mITsvqmko8h/z
vwKBx8J5BeZ/sY9Nln85AGeXFIT8BwKPzP9tav9vkX/n4OoFKAj5DwRSWrBg
QZ6P23T+T39DzP8MBB6Ncv5X0+VfD6A5bQUh/4FASqeffnqWj0033TRdcskl
o305ww7rW3311bP/7yz7gqr8O7/RmYeBQLfhxBNPzPwffrw6H7cpKPV/7L/z
zAuq8u88Y2e+BQLdhsL/m1/c2v9vVprz85xnZMZZHVH4jf7if2eD3XHHHaN4
lYHA6MB8PP6x808vvvjinp+bYWhGNvuph+7666/PMXLdzoZ3pvG66677mPkm
Vfk3/9dZ7oFAt0FMvM466zyG/2Pvzc5zrqGzAfbZZ5/cS0dunA1al/OizTQf
P3582nXXXfPMn4Lg/wKBR+Zjts7/Z+fNAzIjT/y8yiqrZD3gfOMrrrgiz8uu
gy9gdrPzntX+VTm+kP9A4JHzP5xfZv5ndb65c0zFBIcffnieD+Z8Ezz6hAkT
ct+Qs1Duueeejj4TWBzzwAMPPMpn8TPnf+y0004h/4GuxllnnZX9/1VXXTVN
nTo1XX311Znvc3Y20AfONyHvzsviK3iv8wKcDa6m1hlJZKzTzz0ouuDOO+/M
dQFyHiuuuGI+s40eCwS6DTi+vfbaK9t2PPnuu++e+T7+8X333dejB9hH/MBx
xx2Xz1PjB6gbGDt2bJo+fXqOFciV81Y6jRtwPfSYWMB1kvdNNtkkxzT6HnAg
dTqzKRAYLvCLnV8szlcHaBYA2XAmpnyZM4/KmUnsp3Py9AnPmjUr5wxWW221
rDe22WabNHfu3NxDcPfdd3dMvhBH4WxP5zeZdbbddtvl63Xd5n+bfxK5v0A3
g22/7LLL0sknn5zPOJUvMxNAToCtdIYymS42Urx/2223Zd9f7myjjTbKPUR4
Qmclk6lrr702f2/xH9oNuopPz79xBrAzXOk3vc6uV80PvsO6Oj1uCQRGGmSa
vJJb56XqB2Qj11prrZw7UyfofEPcgPfyqfn6t956a5o/f34PN+AsUbVE5E0c
gTtoJzfg9zh/md9CP5FzXAW5d3177LFHrgly/k+dzmkOBNqBct5pVXZK/wzf
AF/oPNX7778/v9dLXk1OkN7Yfvvtc6+92Bo3MHv27HTRRRdlbmCk9YCYw/nM
F1xwQZo5c2buaZDb4MvIb4pP8Jt4jU7jKAKBTgJZZSOL70z+2VB5QOdlmxXi
rOMHH3wwv5883XXXXbmHaN68eWnLLbdMa665ZtYFdMKcOXPShRdemOWTnA6n
/Inx+S5qFE866aT8+9Q00lt4CbqAr08H1aFmIRDoFLCVuLOjjz461wKyp17k
yuyQm266KfcIFL6PfddLg1OcMWNG9gHGjBmTuQFyKY7wfXjEojuWFH6X61u8
eHGONfbdd998jinfQ6w/efLkfB34vaGe+x4IBB6GeJ/tVEd38MEH5zrAEudP
mTIl1wawvWSx+PdkWwyuf2C33XbL/oMcI7mUYzzttNPSjTfemGuMlqR+yPfT
M3oW9e/yS/gnfA4cpHMNXFPk9QKB4YGYgK3VU48T5NvjCDfYYIPMFaixpSdK
rZ0Xv/zKK6/MuTc+Az+A7lB7wz7LvdMTg5VT+QTfSXfwJeTw+Pp8EvG+vKQc
JP+ik+sSA4E6gkzLp8sJiunJHB1A/rbaaqvMsekjIH8l1uYTyLOdf/756cgj
j8zn7uLk2GvxAd5QnqA/kPt777031yUtXLgw7b333jlPKe/ID1G7aL7P7bff
HnIfCIww6AG23vwwsienzq7zv+UC+feLFi3KMltiAvqAz37eeeeladOm5c+I
1dUZ9DV7yGflGekHHN4hhxzS87v4EnSJGQbO8w1fPxBoL8QEZE+cP2nSpB7+
bf311++pseHfe18BPcCO4w3UHqshuu666x7z3ThFOQb+vL5D/CNfA6+/xRZb
5J8504NvEfm8QGD0gMeTW1f7p6+Ofy8mkHcXk6sBIMvVWmK1RPrwbr755swd
FvDf1e75N9+nNplfIY+Aa+BvnHvuudn/WNocQiAQGB6QablAPTZ6hsk+W62n
YMcdd8ycvBkc+IPe5LbU7qkvUn+EHzS3R78hv0K/vlpDfcfh6wcCnQk2ns/P
95cfJMNiAn3Gcn9iBXUDbHzhBshzqd3DDZTeIj4Ef+LUU0/N9cf8jPD1A4HO
Bz2AA5SnwwmqAWDLnTW433775Xm8+ojUDaoJ8j41QmIHfgMdoN5A3iDmcwQC
9QNbbbam2QFqAOTrxQP0AN7f7IBjjz0284D0A7lXXyTGFwPoL8L/BwKB+oKf
j/9TI6QuGDfAvy9nc5QzOkvfoN6DkPtAoFkQE6jHVzeghkfdLn5AbaAeAzG+
XGHE+IFAc6EuSA2v+fxnnHFGjvHVBkV/XiDQPVDjw96H3AcCgUAgEAgEAoFA
IBAIBAKBQCAQCAQCgUAgEAgEAoFAIBAIBAKBQCAQCAQCgUAgEAgEAoFAIBAI
BAKBQCAQCAQCgUAgEAgEAoFAIBAIBAKBQCAQCARGG/8HT54sqw==
"], {{0, 161.}, {
           256., 0}}, {0, 255},
ColorFunction->RGBColor,
ImageResolution->72],
BoxForm`ImageTag["Byte", ColorSpace -> "RGB", Interleaving -> True],
Selectable->False],
DefaultBaseStyle->"ImageGraphics",
ImageSize->{60.703125, Computerized},
ImageSizeRaw->{256., 161.},
PlotRange->{{0, 256.}, {0, 161.}}]), !(*
GraphicsBox[
TagBox[RasterBox[CompressedData["
1:eJzt3Qnc5WP5P/CxDYMaKlmSopJSoexNRAijaFCaUo0YScY0QzUZTIORJYwR
UilKNWSyJHtE0jYyEaN916Z90fr9ed+v1z3/2/mfZ5s5Z875nnN9Xq/DM89z
nvOc5Xt/7uv6XJ/rujc+5OgJk1ccNWrU9NUe+8+ESe/eZdq0STP2X+uxfxw4
ZfoRh0857NC9phxz2OGHTdv+kJUe++bdj93WW2HUqJUf+38VCAQCgUAgEAgE
AoFAIBAIBAKBQCAQCAQCgUAgEAgEAoFAIBAIBAKBQCAQCAQCgUAgEAgEAoFA
IBAIBAKBQCAQCAQCgUAgUFP873//q/7973+nm68DgUCgVfjLX/5S3XvvvdWi
RYvS14FAINAqPPTQQ9X06dOrww47rPra174WMUwgEGgZFi9eXB1wwAHVBhts
UF1wwQXV3//+904/pUAg0CP4zW9+U02ePLladdVVUwzz/e9/v9NPKRAI9Aj+
8Y9/VLNnz67WXnvtaty4cdUtt9zS6acUCAR6BPSW+fPnVy984Qurddddt7ro
oouq//znP51+WoFAoEfwzW9+sxo/fnw1evToasaMGdUjjzzS6acUCAR6BA8/
/HB1xBFHJA1m4sSJ1QMPPNDppxQIBHoE//rXv6q5c+dWT3va06qXvvSl1c03
3xx16kAg0DLgFPruhhtumDSYf/7zn51+SoFAoEfwwx/+sDr44IOrMWPGVNOm
TUs5UyAQCLQC6tSzZs2q1lprrWqfffapvv71r3f6KQUCgR7CJz7xieq5z31u
9fznP7+64oorqv/+97+dfkqBQKBHoP/ola98ZfXEJz6xOuOMM6JXIBAItAy/
//3vq6OOOirVqY855pjUOxAIBAKtgJr0Bz7wgWqdddZJPY/mNgQCgUCrcOml
l1abbrpp9aIXvai66qqrwgcTCARahi996UvVy1/+8hTDnHvuuamuFAgEAq3A
T3/602rSpEnJB/OOd7yj+slPftLppxQIBHoE4pX3v//91VOf+tRq7733rr76
1a92+ikFAoEeAb2F7vKSl7ykes5znlNdfvnlocEEAoGWYeHChdWrXvWqavXV
V69OO+200GACgUDLwPdy9NFHV2ussUaamfmjH/2o008pEAj0CJyFZNb3M5/5
zGqXXXZJNaVAIBBoFcxrMAsGx3zsYx9LM2ICgUCgFXCOwOtf//qkwegV+OUv
f9nppxQIBHoENN0TTjihGjt2bNJ6zegNBAKBVkGvgHkNzhZYsGBBzGsIBAIt
w+233556BcycOv300+N86kAg0DKYmfnGN76xWmWVVdL5AtErEAgEWgXzpWgw
5k1Fr0AgEGg1PvKRj1Qbb7xx0mHmzZtX/eAHP6h++9vfVn/961+TTyYQCASW
FjfddFPywein3nbbbaspU6ZUH/zgB5Pe++Uvf7l68MEHq5///OfVn//85zhX
NhAIjAjmNbz5zW+uVlxxxXR+rPOR1JO23nrrarfddktnmpx00kmpD/IrX/lK
tXjx4uSVkVvpi4zeyEAgMBD4YI477rjUiySG2WabbVJNafPNN095kzMfN9lk
k2qrrbaqdt999+otb3lLmu/w+c9/Pnlm8M2vfvWr6m9/+1vKp4JvAoFABs/L
mWeemebZbbTRRqmf+otf/GI6y+Tkk09OHl+xzDOe8YxqvfXWq9Zff/3q2c9+
duKhvfbaqzr00EPTWQRmPtx5552Jb+g3+CbyqUCgv/HII49UM2fOrJ785Cen
GEVcIg6ht9BdzAC/+uqrE+8ceeSR1X777Zdmx4htNthggxTfmCPje7vuumv1
tre9rTrvvPOqa665Jp3h9t3vfndJPhUIBPoHziv59Kc/Xb3sZS9LuRHu+MY3
vvH/5ThyKBwhNnGG0pVXXlmdddZZSQvWWyC+edaznpVm4olxzA/ffvvtq/Hj
x1eTJ09O+dR1112Xfv9nP/tZ4rQ4/zoQ6E3gD9zymc98Jmkqa665ZupznDBh
QvXZz362WrRoUfXjH/843aexr9rvyn1+/etfp9gE31x77bXV+eefn7gEVzkf
8ulPf3r1lKc8pVp33XWTfrPjjjumub8nnnhi9eEPf7i65ZZbUm0Kb/3xj39M
fBPaTSBQb1jD4gdxC25Ze+21U+yCX3CCGrU45j3veU+a26BGjUcefvjhpp4Y
j/foo49Wv/vd7xJf3HbbbdUnP/nJ5Ns76KCD0nyZLbfcMmk2ZkHIq/DPDjvs
kLRieZc+KL/n98U3eC34JhCoF6xXs+suu+yyVHum6dJceHfVjF7wghckjRfP
iDnUqf1M74D+JLENj6++AhzVzH9H06Xd6DWg3dxxxx1L8qlDDjmkGjduXPW8
5z0v6Tb+llzK33nFK16Rfi6+wWtmXsmnxDaBQKD7gRM+/vGPJy6hze68884p
r7n77rtT/HDJJZdUp5xySjq3xHoXc/DDuPn6xS9+cfXqV7+6mj59evL9qhc9
8MADyfM7EN/gNNqufOr+++9Pc60uvvjixCNvetObEt/Qh3GNGpX4Rm0c/6lN
yb3ETYHehOtDrCrnjhln9YTPUBwwf/78lK/ol3bOvX9b934u7nAfNaOHHnqo
uuGGG1LMoWZEp3Xeo/wm84CYAwe84Q1vqKZOnVp96EMfSnzjd+VSerGb1adx
kL/D1/ftb387+YcvvPDCasaMGanXkpdY7EQrxoFmX8V84N4EXvnFL36Rrhv+
BvscL1XwTL3wpz/9KX1+eILeIicSf9A5BoKakc9ajuJzl1PxyagZ4SaaipqR
2EauQ1PBXW9961tTLnXFFVek+jS+oakMxDeuJbEPDqEr33jjjdU555yTciXP
V68CP02gd5D3O7n2qaeemnJw/obXvOY1aU/jE7fvBc90N3yOtBCeFpqtmEDc
4Yx7ccpw9dP8OOISWq/rghaj7qy3QM1os802S7GN2APX5OtFjiMXwjdq33hk
sPq079OI5FL4CTeFT693INc1m/VTn/pU8m66XvTvq2E+6UlPSrmy6+bss89O
+5prJT7/7gRO4Ds54IADki/Fmhcb0F6XtTYjX1Zbvu+++1KtWX40a9asdN7J
HnvskTQU8Y2cKvcX0G7kOxdddNGSepHH8Dxjr+pt+Hx91q5H1wB/FP+CHJgG
t//++yfNz/XC64lnDjzwwKTVfe9734szuroMcqLrr78+cYvP0fp2nv1I4pbh
gqZin6Gp0Hvl0zwuatziG94Xuq26FO0m51K5l0mt3Cw9+RHuw11Rm+4NiD1c
G3xS8maeCD0m8nS+TNcIznHmn76UOXPmpGvDfohn7Inu42fi59iHOg/1mi98
4QtpT+BvUwO2jtvBLc3gmqLtyIVouGpAcjJ1qT333DNxnXkz4htcoy6llrXv
vvtW733ve1M+h2fiWqovXGf2OHvGRz/60ZQLiUl4Iuw18nU+BLXHHJvYp1yj
+lGmTZuWtH48I++m0dD/8FTkTJ2Bz1R+K35Qi/HZWMuzZ89OOm2nYoKsFdN6
XR/4Q57GV7PPPvskT5/6Ny4U34h39DDx7AXqB35LvMEfTu9XexRDy33win5Y
vig80eyazBoN3xRPOF8WXrInTZw4MfGVONn9Is5dfvjDH/6Q6r3yDjEoLdc6
5ofrpn4fz0V9AOfRcMXH6gae90477ZR6s8VbOClQH+T4gx7Hb7DddtulHAe3
8Gsff/zxyTcpz8nXY/ZHNfOGqznS+dUQab65x22LLbZIsbCaKB6L3tn2w+cj
rvQ5+AzEAT5POUq3c7xrDZe4luTZeq/lVaHp1QO5vsivTT/RR09rUw9SV+Q1
MJ+s3OdyX4nrUy6PK5pdq9lzrpbksXlDxeV0YfnTsccem64Z+1U37aG9Au8/
nhe30Nt9priFRq+2U7cZup6v6y7y6+5H7nWVy+APuQytj3ZLa3nd616XvJN4
B//keYf2DbUAvEC7VT/CSTwMA33uvi82ouXxfMr75dP8V/py586dm3rlBsq5
AksH7yc9w2eZ633vfOc7k64WfB5oF+wBeuzltrRYuVDWYs3s4F/hk6KhZc4w
y0ycKn/iZeDTxA/2RBzzuc99bsh9BZ/ZN/XE8lbRZvg7aTNqpfpf6HzRU7Ls
8F6LK2mkuIXmQk8TSwa3BNoBHKE2KFaQf9PLXHc4Qh1QPMLbhEdy7Jzzp+98
5zspzsAreIivTrxDs8UXegWGE3vkXhZx0QUXXJDido8nbvIcjjrqqLTnls8h
MDJ4f8WXPhvvq32A5oVb8E4g0EpkTz+O0Adr9kZe0/rh1Z/FDnIlsU3+HXEE
f5zcx2xDfgS84nqVE6k5877grJHmNXhG7wiuoyerC+A6MTyvHk8Ez3jkTCMD
vVxc+trXvjbloLQ03KL2mz/bQKBV4EOizfJB0ljECOrF1rLYWQxh1nvJEdmv
K46gBdJi/Y7rVT+JnhG99O6zrOeei9XVkXCY2IVvL89RzB5g9eysAQUGBm7B
1/wt9g61ore//e3p8416S6CVEB/wPNi3+B6t26yp8kOa06HPXgyROSLzimuU
X1ePPR7CLWpJNBN1Tvpuq3N4sZL+OL24+vppzHQDvbiHH3546pmjGcU6aY7M
Lep9OQ6kt9x1110RtwRaCt5bHgG6iBwcp4wdOzatVbwifpYL5Vwcv8if5CNm
Eopr+FWsb+vcY6gl3XPPPW3P3z0P+y1+EyvluImGTDOiD+HAWDP/D7iFLzdz
Cy+kWBC3hN4SaBXs7erA9np7V64Du954q/Smqs/kGCDrMmo6zrRxHh8vthlD
2a+r7w3vqCUtL71V7EUvltPpudVPaT/2nPTZ8m/qeStjr35FI7fYS9QEv/Wt
b0WsF2gJ5DV4hSbi3Cs9hlljoZXytomdy/Uov6HdykcyF+UzJORPHsd1yx/X
KT9T1qTVvukIPO35DC88I6bCjfJA3Lc0N3GQNer/4r7sRc4375PbcB/PfT2O
99otzxfIjy+esO597e/6Hf/2d93Hv31ND+ONK/+273s89/N/vkQ8i1vsIzhY
3479IGrQgVbAdSQXMhuVXmKeBk8Jvjj66KNTHz7uyf2muW6jh4h26376AMQs
ajh+x3qmsXRDj2r2AZoHYq6a2hd+UVM3R8TaUvtSj9W/MNIbDYrvz/uEa8V+
5c/NTON/He7j4XiPY3atmz6uW2+9Nf0d3/fe0s197e/6Hfmqv+s+/u38eP2j
fI/l36aBi+k8V//nU/J+2BPELXQqOVHELYFWwbrDE/QSHKGGTId1DoQesTIX
sufp43Dd2//FAurN/G2uU+vU79g3u61Wk8/OoM3QiMRY9CE8w6enr1ada6Q3
3kLatz5dvZzqa40/l58N9/Hc1+N4T91oXvq3PI7vm1mBx33t7/od//Z33ce/
fY07/W75t+0F+rc8V//PuazYhd4ibgm9JdAq4A71Zdxihpw1p3ed/1v8nTlC
HK5GbY9Uo3bt0nvxC56ZN29eqjMtjY9leUN+R9/V58a3ow47atSodAa7/EB/
zUA3+g292vvl33leo7WqPubn5f2tXxzhd7xn7ufmd9wfR+Tvucnf3Mrvtevm
OeBWr93nLs6KnCjQSshh6J+rrLJK8snpVZaTZ41FLsQHK8Z+97vfnfZ4nMJz
5Wv9hWJ3v1M3r6x9Wu5hr7fG7P38x2YCD3SjC3uPaNb+Lb8Q5+Eq+YiaVXl/
XG3WGg43E9T93Gjh7m8GRf6em/wFh5ffa9fN36etee28dHSoQKCVkBvxoLnG
9Car3WbgGD3N2dOfe4XE1scdd1zSANSo65yr05/5iL1+fZNyO3WngW7iHtoT
zdq/8aqc0b5PSzZ7ory/+4rp5GVZa3XzO+4vLszfy+e0NH6vXTefrXqf1+6s
IN6hQKCV4GvVF+gaM7tSjShDjcEeJ2ensYj9cw+hXAmvdHsuNBS83ryHi8/6
6Tw/XEjbXmGFFVJ/NF0tEGglSn4RozgbJMM+am47j5p6tZ7nXpuBUPILj7K4
okSOM+o8L8Q+4DNr1G3lvXT8FVdcsdprr71Sv3sg0EqU/EKnVVvJsKbEzOY/
qd2aidxr+p+arbzQ63/f+973OE8vfTvPvqrzLEU+OTNFG+cqyPUmTZqU4hc5
Mo9CINBKlPyiluLfJXBM9mz1ItRM1G29/pNOOulxfh31MH1M1l6ZN9YJ4kx6
tBx35syZ6TyxDPqQ8z28djxDSwsEWomSX8TK+v/6CYPxCx+b2pIaszpTHUGj
VxNbaaWV0nkiYpmMkl/oMHrQA4FWouQXe7Xeon5CmR818otaMX8Kb6sZD3UE
fuGdbFaDDn4JtBslv5hrWeov/YCs79rf9Uc04xc+OR6XOqLkFz1i6n4ZmV/o
L3qz9IAEAq1EyS/+328aX+aX0aNHJ+9cqTNlfuGnpfHWESW/6N/Q65mBX5wJ
pH6kNs+nEwi0EupDrrt+9ViV8Yt+77K+ov+Ph16/Dy9hHVHyi/kapf6S/S/4
xfxLfBMItBJiYrUD15/zefs1P2rmf1HTdZatXiNcU0eoH4lN8KeZX/oXM3iP
9Ybgl9BfAu0AD4Rrq5l/tx9Q6rtTp05Nvv8MfUM8y2ba+LqOwC/q0vK/Rg9d
/uzpL8EvgXbAfCi+F+tr/PjxyfPRT3AWE3+y16+Oy1OXoR9Rzyd+MTemjpAf
5filkV9KfdfZDnpdA4FWgt6i98T60uvWr/Vpa2z27NmP01+yvmtmgz6sOqLU
X+RHznvPyPwiP5Ib9lPvVWD5gOefruv6M7us9Hf2A7L+MmbMmHReUrP6Ua/w
S2MPQMkveiP0mwUCrUTZo9+P/rrMLzx0NJZy1nfpfzGvpY4o+UUe3FifzvmR
M6XpvYFAK2HeCV+n62/vvffuO/0l84u5Nvp0yj7pzC9mEZtJUUeU/DJhwoQB
+wP60ZsQaD/EL87q69f6UeaXlVdeOeUI5QyDzC9m9DqXpY4o+aVRvy/5Jfqn
A+2Aeom5zmLkfuYXa4xHvvSYZX5xNoI5OHVEyS+D1Y+iPh1oB5x55rybfo9f
sv4kX8yguZjN3Q/84jy10vtTN/BFmi/BL9prM4rqjNL/EvzyeH4xk9sc817l
lzxfSv3ImVX6BeoIPanmn9GoaWheV6A7MNj83X5AyS/q86XHjKZr9kuv8ot+
RrmxsyP0CdDi6ggeC/zIR8AnGHOyugf9zi9lf4AzEcz4z+j1/MhZse9617uq
1VZbrbb6Cz2ez9ocMHU+HiZn/Qa6A/3OL2V/QON8KZyy0UYbpbMN9TrWESW/
NM73cXaK/V7vQB35RW/VwoULl5yRZw7APffc8zgPU6Cz6Hd+KeOXE0444XEe
Vp5dvdPOXqzzfMxyfl0z/25d59eJU84888zUg+pzsgeEB7m7UPLLnnvu+bjz
SfoBpf4iVyhnLM2fPz+dS63H0ZmKdcRg81/qzC9iF+eG2hOdzeV1lN7kQHeg
5Jd+9FiV/KJ/uuzxK/27vdB/xJ/drD5dR37Ry6Anc5111knzBS+77LKIXboQ
/X5+QMkv6ps0iYxe89fJA2+//fYlPyvPV6sTv9ClzftyTvFaa61VTZky5XFz
hQPdg5JfGuuzwKskZ+Bf6kXdrOQXPsNyxnWv8cs222xTXX/99Ut+5kxHczHV
p+vEL2bwibVxC850Bl546roTvALZXydW5rcroZ/6kksuqa688sran2XfDCW/
WGulN8tr3nLLLVNvdV3rR3QKc23WWGON9DrvvPPOJT8r52PWxf/CP3D22Wen
nnazS33Ngx7oTlhPzq3I9ctyPitYY7vuumuq4cp3b7jhhrTHl3XcOqPkF7P0
S2+W2pIzc/3c664rzCZ3tjgvXdkjXfYHyJO6Pccwm8dnQkd6whOekPbFe++9
t2fOQu9F4H4eiIH6G2n01hgPCC8IrnGOBx6ihdb9sy35pfH8DtwrduOzq7Pn
XF+Rsyh9lrSLjFLfNcOw27V9s8+OPfbY1M++2WabJc29fD2B7gNdJfdPN8bP
IEd3bZoPsummm6ac1//t9c4cu//++xPP1FGbwY36Vnbaaacla8zryTALxtr0
HpRzYeoGr1OffLkWfY/eUs5evvvuu7v2daoN8QtsvfXWKXZxzdZFL+pn4Jfp
06cnjY/HWp2vnHEN/s33edZZZ6UZrvJemoRzgSZPnpz82XSbOmkzYm0xybnn
npv2QmtMbHbNNdf0RFw2GGih6oT2h3z2tvfgtNNOS3o/Huqm1++58OWaU2QO
mP2AptsrOXovw2c0b968asMNN0yxiTPQL7/88hSLlp+ffU1/rfrm8ccfX+24
445prj7/wXbbbZe0GbGAmmc5w7bb4LmJSfhAeD/pSrRPa0wOKEfCsXXjy+GC
PmrG94knnpi4xWfutetB4iNR67366quTDlXO2uok8J3PSi87Xff000+PWZ41
grVmBi8fmTXmutOLI1eyx5e1P1+rM6jdil1ck+q3Pnf6sP4yjyen6KacKecI
1tZ5552XciG+/7Fjx6bXzafLZ77++uunGJyXl16BU7uZL4cDr11+gTN9bnJb
n5e9wfmU22+/fbXFFlukPcYaxrli2muvvTZpNJ18/fa1u+66K+Vv8qKJEyem
nqNuurYCg0OOJC7hX3Vt6XPfZJNNEl+ImWn21lmOZ1yvfodWYW6kPX/zzTdP
a9OatXbVcx988MG0B3Y61ra27MfydzG2nmhrC6/wT8yYMaO69NJLUx3Xv70O
60+/sX2zG/lyuLA+xaJ8L2YYyGm9PjyiH4lG6rP33tBO8+fvvdl5552Tlq9n
xD7TiXzE33VdZp+unK5b4qrA8GENqk+qR/PZ2c9oLPrG1I9oLzQYvJL5wv/V
n6w/c31yTCAG4ksTa9MzrO1OeLfFWvbfG2+8McUjO+ywQ+qzVX/IvKJ2Kx4T
2/AW0rI9b140r8PrwZ8XX3zxEr6sA3CB127eLo6gLYlPcEf2GuAVPYI+RzkI
vXTBggXJZ7jVVlstef0+fzyrZuh9Wl77hfdavMWnu+aaa6bn1ejPCtQL+EOd
UvxhXdnr6Sz0Pz4Z2gzPXVmLyJqG+sMZZ5yR+iTtjznWdn6gNU6bWR71CX9D
vGHftbbEIZ4LvrQHqsfjPXzayHv0iewp5BHFr/Zy2jfekTPw/3RrzmTt81v7
LMSeehrV+3yG8iA9EIN5Jb1+cSk+Vbv2fvld14FZd/rI8dCjjz7a9teBz+RD
9gR631VXXdX2vxtoP+QB1qe9T31lv/32W7I+xQDibPu8uWGlNmPN5XjB/uh6
dm3KNXAOr6UYqJ31XnxhfWR+xA/0IToDfjST7r777hvUN5HXKG9MXqPyRfv/
LrvsUp166qlJE9Cr1E05k/3e/u415lhSLiR3NftTboE7yxi0GfLnr2ZjRqj+
ERzl9ftMzeGizXn97eJZ77/3Pu9T9q2yNyxQf7h26PS33XZbikFwi/jajQZs
Xoqf0WZKvsi5Fk3DHijXkj+7RukfznLmY2ulNuOx8B1u4/O371pbNFvxC26z
XuQDw+UE3Cn/zzUzcTq+xFk4x9rrBo3Jni63u+6661J8QmOxF4g5cKznKRbI
udBwkf0/8l+6Pd8sb4LXj3M8rp9Z963cL+R2N998c/J7yovCp9vbcP3ii5yb
yxVcv+IS1xxtxvXbeJ3ZgxYtWpTORZTDu7+c3toXA1kPtI9liXn9rnyFHwIH
7LHHHolX/B0x08knn5yu1WWpA/kbnicfr/UqLqDhqDmVr2N5a0xeD/1LLEGb
5o8UY7jh1HPOOSfVy5Z1/Wdvgll/M2fOTDmvucQ+Rzkkjd9cmZFw92CQf3lf
s6brfa+L7hVYesgp8IXPW7+KnMM6s0/aY/QY026aacBqvTwXu+22W1r/NA25
hhgo+2ZGsgY8Lh+ctXXKKackXtG/4HHVl4888sik3aqdtMrHYv3Yr/kv9PPk
2N1r8jqsP69joDqL5+w1Dncf9jhiqMY16/dxhvzVey4XElPk/EUMo17Uar0r
7zNmbU2dOjXFsPYMHCBOFa/y5w2Vfw0Gn5XHUR/gzXFuSr/NDOlnuF6ta/Eq
Xx5fgliBjyRrpzRgfXTlnuO6kb+47l0z6jM5BvIYdB6a43D2P9evvIQPDq+J
2TPP4T2zQbIPtdXIGpPXoW5Kd8yvY999900xg728kdO8Z7gXH9Kg5B2DrUHx
gtwz558Z3h+xkphBfVkMhVPN2ONHsvZpLO3a77M3gc5DJ6Zped/tGfIyvC7O
XRoN3LVl/6Lpup6yT7dbtfRA++BasD/edNNNqRdEzpRjc37evIc25iVyCNyj
DqGnSZxN0zAHwb412BwPj+O6dV07azHXkK1t+ReOsraXRw01a0xeh/VA58kc
pxbeWEdVy8K96uL0cq91sDn3/CjyO6+r7N2Wc8pHaVp0a3/XudJ4je9M/Wd5
6RT+ln1G7dpz9TnQ5tTCxXhiPfrdcPmBpkzHzfN0aT7h0+1vZL7I/ix7Dr6w
n7nmsm+m7IHMe6Drz/WkJ8E1ORC/lPUstRt/Q8zgb1ivzo2mwboWl3d/ntfl
edF55Ezq+Go11noJPVrqOGb1jxkzJvVxiWUG4gK1E702OIuOml+XXEGd3GPR
W+gu6lyD5WXthOdFA5fj0mZ8Nmpt3gcaMM4fjm/G4/BxumZouvYe8V431ecC
nYO9LPvPxcy0mVwz4keXy6gbu87yNZPrM3hG3YeuV15Pvs4asXqzXMi+Zs3Z
v8XiPBGNdfLlDfsznccamzt3bsrPGvfdfBaBXp/c64QrB5qNpIdBLKAvCHfl
XM/7xxtw/vnnJ71H3agb+vxy3wjNyz5DBxLPyNtoM64L8d5AeZt8kT5vb3LN
eL9inm6gRO7xydqM2pJ8Kefm8oPca13ygb3Lv8vYw7/xjZiGr0v+JB/wePIB
NSl8tTzzgaHgOeOVZr0Ejfyy8sorJ32bvtCsfoaPrU3xDp3HY4LXKq+i73bj
TMjciyFv9LmJY+hDak780mptOLHRNyWXFvvgU3xEPwsEmgFPWGdiEteUHEY+
Y29S2+G9E9M3y81zbeSOO+5I+5l9UJ7g99Ur/K442r7frbNKmqHkF/3aciTn
aphLKQ9ofC00cnp5Pnu+Tt6yspeUNiNvFMvQVXCqnE5u6PMXe9lvaHiuD3Gv
PaUXe9cDrUXWQHnx+Wbsx9aUeo/ah54lPjv7d9Zk7FsXXnhhqsW4JvM1pydK
LuTx6ugRL/mFLq3utPrqq6f6th6GxnyqzvySgTvkv2I0r4Hub5+g6dNm5ID2
EVpw7mEwi7zb53QGugu0A7kMrU89JPdAqq3K1dVHaKRydDyUZ/bTCfl9eTzU
herssZIX4kn8ovZlbam5yX/kDvKGMmfI/GLuFz9+nc9U9rktXrw49Sc4pyCf
KUWj1qOvl9LrxLlRjw4sDegR9mj7ldoITxqOsX/Lu/GOXMj36JpqI3PmzEna
r1yo7tcc/rB/4xd5n5pbniVrromehnK2OI3Y+mvUd+sKnz+OpM2JT2loOEau
uOqqq6b3RU1N3tyNulKgHhAz87CYkWYft3dZY3IF/7eny8Vzn3I31EZaAbmd
15b5RS5IR7KmcAgdVF+W7wP9ml4hvqFhlefW1hl4Rq4nZlWLdjZK1rzlTfS1
3DtZJ30t0D2gtaj78OCag8DrIEfIHnPfr/t+3Qg9Fbx3mV/kDLgEp8gTcYxc
wf5tXalz0yryuZLqt70E+a6YFb+IWfFrnmsmtuH5yb1T4YEJLA1yrdW8BPMO
/H+kPb51QanvZn4Bfjnap9iNX0gfE03U/e3nvcgvcl31d/oSvZ8/isbGz6S+
qI8M5+beSfsNLo54JhBojoH4xVrjy1PDFcPQaPQQWW853uklfrF36I/SJ2Zu
FO8CTx6NTe0Q7+Ab/kk8I6fUS81Pw2e5POfnBQJ1wUD8AmI2tTV8oq9PP5M6
i3yh1/jFazWLx3vh9fEw59eWe+LN6fF+8efhGfVGNX2chGc6NW81EOhWDMYv
eU/HI7QINz7lXFfpFX6R3+hpUDvkL6Tvqic26ivul2tNuU8885Eao/5RMU+n
+0ICgW7BYPwC6mR6NPVUjB49Ovnqcl2lV/hFX4C5MfIi2pIektz30Ax4R95k
lrAZPzwLvJnqauoBtCq1Jo8ROVOgnzEUvwBtwZqz9nqNX+hMeuzlO+ZG8SbQ
bYfDC7l/VE2b15BmI77DMzRg761YJ3gm0K9Qh6cjDMYv1oY1p/+c58598Yyz
zurYH1BCLsObjVv0IOlnHGmfh54kPa+8UeIg2i9/pt5ZHgdnHgxnfp64yH3E
Ux6Pt5h2TNcZTp2KF8nf4ZHksxgK9g3352Gvsw870L3gezfjRi+5nr+B9El6
gvkLZvrRe/UUmB2VfXd1BC+TMw30BSzr+a54I/cbeMx8Xh6vEL5R4zZ/TLzT
6PnO8+rpx3RifZY81GIpmrreJ30celUGm9esb1dfKh8oX8VQfMRH6W/Qp+Vz
gUCrYTaKniPapJmXg/U7iFXwkf5PdWrroa79EfhAjwfPHN0FH3g9y+plyWfI
mF2Gr2jF8s/cb8KfKD7JoG+JH3wG5n/x2civ3F+fgh59+rE5IM6GyHPRmvk8
9Wu4v35M3D9YLcvrtJ94bDkd/2gg0GqIS3jpXOM0y6F0AvGK/gi3OnuZ1ZvV
oK0vfjr+llbWlq1f85B5iMwxNOc9zxsXh+T7eN9xu54uvbPiSPGUmJKmzn/k
/B18I4cTE5lnLD5p7FER52RtTK47WI4kN+Lfodl7XPWwQKDVcA3ax/Uh0SKH
6gU371Kcow4rF6hjHda6VhOz5ulJ5nq26ywA7w+Nx1k0YhRaDG0F8I9cSO1J
nxtekUfls7f1IZiP7L2mH4th3E/O5dyvxnkRJb+oYQ3GL/IxeZE+suCXQLuA
I+xjfGL2vKFmnOAW80D5PcyH0TNQN1jXYgbxgjVt/kY7+1XFhDRjtTY3X+M4
nC42MTNQ/crccDO9aK057/S7WT+WG4mB3F+fgpym3A9GEr/4G7jM/Ingl0C7
wMNhH1cPUlNVrxgM1qI1qf/P+UZ6s+oE61afg9qOGQy00E6cYyR+wAfWNv3H
rFFa2ED6D57xc/UpGguPIy+1/SFjJPwiz/VYkR8F2gk+Vbm+a5LWKUcaDHm+
lPs7z4QmWifgEvVosYu5UeZxdGLWhnoNvzCepvvyDw+lLeNGuZKYx34ghnQO
T0bJL+pPclmxT7Ob90E/VeRHgXbC3AX+06XhF7MkxfN1gbyE30duYd6CM2g6
dY6RuRhmP3gf5SlytuFAfVv/kxyJ5utxsiZf8os5rvInOVizm3MezI3GU8Ev
gXbB/uc6Wxp+MRfGGUJ1AS/ZwQcfnDRdtV7PvVO+WusbP4gf9BgM19NHL3ae
sdfgPCYcmWeOl/yiRi2PlQc2u5k5rWfVfYNfAu1COX93pPyidqq+UQeUPQ78
KOZE+V6noJbE30L/oNuOZFaV+5vJg5vo1NlDXfIL/lGXEiM1u/G86OUMfgm0
E2JoM/JdZ/zxPO5qQvwtfOk0RX4wOiIt14xiuUWd+MXapXfwHpsb5cwHZ490
sico8wuO4MMbrq/P/dzf3K/GM6hKfhk3blzy24mTmt3wkhgm+CXQTohf8nXG
26VfBoeI2V2v5s7yh9EIeMNoi+ou7s+bqv7U7aCxzJo1K61n2gsPfqfnJ1vj
Ygjvo/eY3284EHP5XPhgxChm1mQPUskv6mI4VGzT7GYOqHohfTn4JdAuOJsj
z6OzH9oXxSc86vjGGjCvTTzuOjTLLl/D5tTyqncz8Ag9U60Iv+Q6cKeB43Cd
99E6H65Ors+Uro4XGn39I/HX8c3oT1XnDn4JtAvZz+Ka5KvwtRhloBvtInPM
QQcdlM6h62boJdbzR8tUU5HPdUPPFJ8RjRmnix/x/FBnQ+rHwCc+I3Uf+awe
xYyR+F/8LTmSzzL4JdAu8K3n+pHZSPoWb7311gFvfOk5rleLMd+uW2E90nHp
S56znr/h5iHtBn+bHJTXX67DiyLXHOjccnmRWt/++++f6kbiSXkrj0vGSPhF
D6acV507+CXQLtjPd99993RN2k8XLlyYNMSBbvoAc72pm/0v1qj6s9ekTsJr
zAvYLWeKeB68R2ZsWt/6LPlxFyxYkLR0Ppd8E4Op23m/s3dXrQ8flbrwSPjF
z5wPEflRoJ3Qy0unXZr6tP5evZHdCPu9Om4+v965cN02e1sMwz9Mx8pzFXh5
9Vuq/eSb/jCxpT4CeZ6v8Xzj7J2R6C/ei8iPAu3GsvBLt/rr6Ct0CfVoerUZ
St2ax8nXzO0y+4XeK46hQ+PEfJPbufm5eVO0YTWxxjxKzKL+jof47gbrhce/
egjUAvGavu5AoNVYFn5Rrxa7dxv4dehE6l80UHPdunmOBI6Rpzr/mjfHc9ZP
TcfVYyROVG8Wg5nZMJCGRKvHU/IsWs1gOjZ9l1Zsj5Cj0dYCgVZDfsMntzT8
Yi2Us9i6AXhEf/S2226btNM5c+akuVndDs+bL0UPgxkY8h/r3+xwe4D4i49u
MM4Q06hLmVk11LngYh8+SnzFYzDYeQmBwNLCfDU5/3D1WmvX3ur+5n0PNS9m
eUO9XD2anoE3m51j1O3AIfIXcQreaafP2GPH2QaBdsGcNDqFnF89YSi+sF75
wfSw0B471X/cDLx0ZgPzB3o9fMh1iF0CgV6FGJnnha+VTjHUTF0xPD+sdUzb
7SZdw3PnCcEv5nWL/esWuwQCvQTrj0dL3DKcM9r93P3MeRzKb7q8IX5xvoHa
rP8P5wygQCAQGC7ommazdXL2QiAQCAQCgUAgEAgEAoFAIBAIBAKBQCAQCAQC
gUAgEAgEAoFAIBAIBAKBQCAQCAQCgUAgEAgEAoFAIBAIBAKBQCAQCAQCgUAg
EAgEAoFAIBAIBAKBQCAQCAQCgUAgEAgEAoFAIBAIBAKBQCAQCAQCgZHh/wDk
A1Df
"], {{0, 199.}, {280., 0}}, {0, 255},
ColorFunction->RGBColor,
ImageResolution->72],
BoxForm`ImageTag["Byte", ColorSpace -> "RGB", Interleaving -> True],
Selectable->False],
DefaultBaseStyle->"ImageGraphics",
ImageSize->Computerized,
ImageSizeRaw->{280., 199.},
PlotRange->{{0, 280.}, {0, 199.}}]), !(*
GraphicsBox[
TagBox[RasterBox[CompressedData["
1:eJztnQusbGdZ97lpiMZIjEai0bQNTdsUAxiVTwwoBCJEI0k/BJGQCLblolBD
SwuFll7Ooff7/UZbCrQFwqUWhCIXobRQrhIUxYDFAu2BAsX7fT5+K/mt7z/v
WbNn5uw9c2bOfv7J2jN7Zq0173rXev/v8zzvc9n/hUcdduRDHvSgBx398B/8
OewFxz35Fa94wav/7yN+8M/vvvzol7zo5Ucc/oyXH3PEi454xf954UN/8OH3
f7A9+sEPetDDfvA6KhQKhUKhUCgUCoVCoVAoFAqFQqFQKBQKhUKhUCgUCoXC
QvA///M/o//+7/8e+59N/O///u+Gm+AcfvZf//VfY+echv/4j//otmzDpPYN
7V8oFLYf4IDkhlk45z//8z97rtoTDP2GHAXvAc5N2/itPf2dQqGw/vjXf/3X
/n0rV80COSWPc8vzTUL+TnsuAEcllP9mPX+hUNh3oHyUXAEX/Pu///vc52rP
Mw+fID/927/929i5bEd7HvmqUChsT8AVe8JRyjvwFNyX3DKLPunxeRzc9c//
/M9jNiraxm9oH2t/q1Ao7Pv4x3/8x14mYvz/y7/8S//drHzQ8g3v4ZfUNTc6
NnU+jss2KP8l+L+4qlDYnki5Cq7wf3lhow3ke+QfzjHP+l3y1QMPPNDret/+
9rfHeAkZUJ2Rff7pn/5pD6+4UCisI+CW888/f/TSl750dMYZZ4x27tw5Ovnk
k0dnn3326KSTThqdeuqpG26nnXba6IQTThideOKJo9e//vXdsa997WtHF154
4ejd7373TG1o+RJ873vfG1111VUjUuK4PfKRjxyde+65o+9///u7HVcoFLYH
khMe/vCHd68PechDxj7faHvYwx42euhDHzr6sR/7se7/Bz/4wd3xfM7/v/3b
vz360Ic+1Ot12KZA68OV4POzzjqrO5ftYYNbC4VVArqEeoBzqPqFvjh872et
XrLRlnqK9hU+Yz7P32vtL2lTybUsxqDjL8+X52p/d5WA7QpO+KEf+qExDpqV
r374h3+4f8855CmP53v3efaznz26/fbbx+xkrgPSDu328trll19efFVYaQzN
t9g3Lrjggm7+Zkyw+d5x4fM8z/h6xCMe0f2PHoNu853vfKf/TbhHHlT/aNsG
HzF+fvzHf7yXJWgXbW39hiZd2ypATkhZKftp2ka/c93JLcpp9A2vP/IjP9LL
b3fdddeY7wKwb3i176688sriq8JagOeWZ9q5FnvIpPGi/jHL2GIstp8xhhin
P/VTPzU67rjjxtakUq5StktZ6dJLL+3Oye//6I/+aHc+2go4B9ewqjwFuFZ5
nH7wGrJvN9rsT/ug5TllrZ/7uZ8bmy/uuOOOXv5sfT+181988cXFV4WVxpA/
DoAXkId4/nnmlWfmkQPSbsvYZM5XDthvv/3GzvfZz362k6scU6xFpd7JOOc7
xlSOWdpIW2e5plWBvGT/wFlXXHHFTOuD6sD0xXXXXTe67LLLRrfcckuny8lR
2rWYD9JGBuhH+D91b/kd3i++Kqw6GCe59sPzzDpU6h/KU44Bx5nfTdocK2mz
+Ymf+Ind9EX2+9znPteNydRdtLMIuIljUragra2v4zzxv8sE1+L12jds8/CC
Mmer46Ffv/zlL+/6Wn3QPqLPzznnnH5f+zV919Gri68K6wBtr3ID8728IM/w
/o1vfOPozW9+8+jaa68dvelNb+r+32h7znOeM/rJn/zJnrOc+9l+5md+ptdh
HLusawHGHmMy4014z/p6ax+jrUPXsKqwL5UT4ZaLLrqo9yffaDM2WY5BToKf
0//8iU98YtfPysRyF7+nbVDkuc4777ziq8JKo31+Bc9pq7fAWynHzGIncgwx
LvBN/MxnPjP6gz/4g06PS1sW5+Yzxpq29zy/chc6C8cw9hzvk8bUpGvbm+Ca
htb50HNnkQntk9ZXAcB3/k8fc251RH/zU5/6VOcX6nmS24uvCusAbe25xnbJ
JZf0cpXrgjzLyjCz+gsoDxCHAtQ7n/nMZ/ZrWcoB/v+JT3xibBxlu9AH0zZN
22hr7rvqNvfkBK/FNYPNwn6De1qbI/x+5pln9lznPVSvhDOVxX76p3+6O/51
r3td9136PaS+bWxhC/1VvBetrFwo7AlyXKc/4aT1waF9pyHlBtf/4C98vF1r
VFaCs04//fRunxwH/h7clOtovIfDGAuOnRyH6ljZDm35bW46f4/9F2n/WiRf
yQ/f+ta3drMRwj/PetazevnVa/S6kaVomzZK7gk+Dn6fa7Xcx/e85z3d+u7x
xx8/OuWUU0YvfvGLx+KLPM74xkJhs1g0XzF+Wn9Un3lsVK7ra9difkdmct/2
91q+Yl9sWsJjUheEn3JdzN/3NdcikyMXpU8ukq+yf9PHIddIzBMoX8nd2Ntb
GwDtYn995Y466qjRU57ylE7PTB+w9FXhFf5irlDOAqvqw1tYHyxDvgKp38EP
PrvY433O00cb+aBt5xBfIY8RQwfaXAfqIJmDRXz3u9/t2wL4Ltfb0i601Vgk
XwE4l621PeY9hKvoH234bPhG5P7wkWuKn/70p0e/9mu/1uvsuenzwsZvuk7D
dx/72Md634l2PbNQmBeL5it5SbuSUN5hjLQ+pchYrEG2vqOT9EHWId2Xc/Le
tt16661dXBx6y3Of+9zR0Ucf3XPU0HyPTLVoOWDRfGX8TcpVvmdecJ+Ue+Ev
+cqYBnVtYnpsq/q7cUDJTW457+R6yKqv2xZWH4vmq5Rp5JIEz7JrhenjwDhp
fRon8RX+V8D9yV3wO7/zO4O6UI6v17zmNd3+rJel3qLMsSjeWiRfKTOBdh6g
L+iX1n4FeJ/+V2z777//6AlPeEJ/LPdJvzfOzWf0qX0Mx2Gnt68zDuKmm27a
kusrbG8sQx9Mzsp8u7ySU8Xn3bg4/m/X0TfiK/y8AWOCdUftxYyZXOP0d4xj
VJa78847+7Ytwwdi0XxFv374wx/uzy9v0Qf4zaUOnHGE+rAYi5C6oeeiT7HB
79q1q89JSr/97d/+bSfLuk8bX/qoRz1qoTp2YXtgGXyF7NKut8lZ11xzzW7j
l/gd4kuSOybxFX7bcN5tt93W+xp5PsccPJUygNeS8gd5qFr7yqL0l0XylbLh
b/zGb4xxjP0Cr2QOjlxfwJ/B9thG+st1jRe+8IW9zAnX5XqI89CXvvSl7v6p
D2Lvsp///M//fEuusbB9sSx7O8gcDOpuzOlyCM+1vvCt3jiJr9ie9rSnjcW2
GO+jz1jqhW1MkPbjQw45ZHTzzTf3v7dI27AyXtqD8NGfJT8PSP+CIRsf8k/a
j3iVs1o/0byHrg96L5LPsfvN4j9Fe775zW/uFhMPh2FHLBQ2g2l81fphp8wx
S/wISDmJdb+08fpMy1NySBsDuJE+KB9lrM9HPvKR0Re/+MX+eNrA3E8OTr5n
X68t7cPwqPb6IT/IrYAyT+atmjd+MNt2//3397HQv/ALv9DJlfJxypPozbPw
FTwlvx166KGjI444otP/ZvVJo32/93u/1/Vx5h/6zd/8zZmvsVAYwizyVcbP
gnl8/9K/MPG1r32tt4m78UzDVYxd/T/btrV8xTHqH4yz5z//+d3++KMyJuGp
5E0+u/feewdlR44nXkWfy0X5Y7e/y7i++uqrZ+J/6+rIHVwTuiy+mvTDAQcc
MKbP8YrtCD9R+xFsxFeZ4wYOJ4YKzLL+oK/tDTfc0Nu9krMKhc1gGl+5Zu3z
D/RXNsZ2mv5iLI4+ivg+4RPturlrgo6Tz3/+893+s/gzmAeK7bDDDuv3b+3m
mROYccdvwI3tWvyOHTv6GOBF+LgjA9FuuIXrTbv2LFvmD035N9dYua42/8Pf
/M3fjPl5TOKrlFmV0bL/psE4T34v2+29LRQ2g3nsV/pGz4PkDZ5lYjiIaW7P
rX0Jm257XLZtSB+kXYcffni3n3lW+K30S0V20UdUX+3f//3f72008tbjH//4
/jcXFZOTPhbqbPLWtPw8rTwqr+irAVfJaeqC99xzz1h+a+9F/g/gK8+p7/rz
nve87rtWPt4I1rHPNmonLBQ2g2l8lTZX3h955JFdjiVi/3j/x3/8xxtuxMsS
w4FdJceQYyrX7rBhyTVD7ZwUj8P/d99991j8n9eR/Jrv77vvvm4N0vGUMd2e
Y1F8lXp2ctAsOVtzH32dlK2UtVJGwmbntaf/wkb6oP5VvM9c07OuQdjPmefZ
+1QobAaz2q/a3Lt8pr14Fnkg8/xpW0/5AN2FmA/1yNbWPYmv9GFwLKl7tn6q
rkfiG6qs8IUvfGE3vSp13kX4M8CBabdKWUtf1mn9KZckP8EH/E9/8D3+V0J5
chZ9MGUhfo86Y2krm4aMN0+52bYXCpvBNL7KnOHteGljXSdtrtvxqiygPcMx
h72jrTvctnOSPkisDWg5CmhzB4zXjEMx12crR4JFyVb8Jrpf+lrANUN57idt
ri/I/X/4h384et/73tfp2l5b5n6x/zKn2CS+Si5kw7dtXr8Vz9vqt8VXhc1i
FvkqZQ99lx3j0+ojOCaZs3PNymf5RS96UbdW6FiSU1rZZhJfOaaEcbwiz5M1
rQAyl+1IH9NFrg2CRccPboRZ7e17mq8vfVWGOLhQ2AxmtbenbbuV8zfa2jp7
6CvYcN/61reOvv71r8/VzknylWO99WGdRS5oxxNjLPOsLALFV4XCnmEaXzmm
zLH+rne9q4sT+8AHPjB673vfO3r/+9+/4fanf/qn3b74D2BHyRow87az+Grz
KL4qrDP2NB6nPXYS0KuwgZO7va0ZPY/fafHV1qD4qrDOmMWfYZK9dJovdp5b
Ozc2o4wjnKedxVebR/FVYZ0xy/qg4xjbdtaNmgXYuFvfBHXCedtZfLV5FF8V
1hnz6IPwVcZlzDOejcXZk7XxbFvx1eZQfFVYZ8wSP5j5XoaO29PfnSe2p/hq
a1B8VVhnzOt/JeapP5jnt47dvHxXfLU1KL4qrDP2dH2w5YZltLP4avMoviqs
M4qviq9E8VVh1VF8VXwliq8Kq47iq+IrUXxVWHUUXxVfieKrwqqj+Kr4ShRf
FVYdxVfFV6L4qrDqKL5aLl9xbnKB4YebeRCXWZuPfmmvjbgpcq9+8pOfHH30
ox/t6qFRF4ecP8R7znq/9a2jRi45OTgX56Tu0Mc+9rGZ2kd+xbwH5AQBxseb
hz+vx5rVhdWHueWyJkDmksx8wJP8PHk+zCnMvvCCOa6yhouYJ7fCZtDGHiaP
Ms5pI231+riGeXKDeq5lXqN5v7g228q9mqemw2bAb7UxnDwXOeZ5pvhM/hnK
UT2E9pyZj3+W4/0tNmpV3nLLLd09eexjH9vXWPQVZJv9rLC6GHrG87mQn4by
A/s8+nmeE92greNCrr5Z6zptJawRRf6sc889t8urbE5h2khbW64Gs/CW12jN
MmQf+ITrnLcW0KyAC8xXYXuRR5aF5ATntfZ/YW7lWWPU6bfN1Jm1viIgv1rm
/bd2EXIg8J6z/6J098Ji4P1ybOczI8cwPqw9MHRc3ndqit9+++2dTM+GbvDB
D36w+86cw4sazxvhG9/4xui2224b3XnnnZ3OQhtp69A1zPIMo6dwrjvuuKM7
V9ZpWASUB7gn2b5lyauJ5CmR+TeMn/Jez5ojOrkvn5V55N6nPvWpY3Y06whQ
qzKhPL1M20Rhc3Ceyeeufbbe8IY3DB6TnMN9b+vAs59jyX0XVad9CPw2z6Sy
Ps/lkNw/1PZZ+HSI0/iM616ELOm4sg+t5zOpLYv6/fazrR7vk+yi05DPLbXg
4Czr6bKR4xaZ+M1vfvNuNo69MX8W5kd7v7QZ8D95PcmVTk1ycqcDa7TnnN7q
BnzneM1xlPPxrPXotgJtGwDcRBuVqYbkhWnIvnOsLPq5b7nQGljLkLEm8UbK
RLSHtlhrZx6wvzHtQ+efBp4pjucVu/rpp5/e2xetEUndRWStt7zlLb1tvrhq
PeA8rdwOXD/hnqPDaXvidb/99uvWadr7m89r+3nWrctxvQx5IO29rW2lHXuT
rmEWOEZAynKLAufm3u0Ne+AQhtYMs9+5D5utGTSrPphrP7t27RodffTR/Vow
tSqVtX72Z3929Pa3v70/jrm5sNrwGWqfBWqQs5asj4/zkvf66quv7vZLLhLa
G5xrh3LC7A0M6bvKkS3/zrrelufx/IvUL4Z+ByyTtzaSQ73fm+Vq70s+l7Oe
M+3oglri1pdly5qWN91009LWVgubx/3339+/Zw0YPPGJT+zup3V/5Snu9THH
HNPtk+OFcdvyUP6vjiiUD5YB7R9D9VSH2jwvn7a6ZukWexfe2/ShQGc49dRT
u3lXvzWeZZ9tajFpG/BYgL44z/pLYXPwfllHFOSrYzNtScw5aaO0ZgQy9V13
3dXtw3G1plJYReS8yHqq/7O2vWPHju6Zpq61zzYb3HXjjTd2+zkWWn5aFd17
X0feP3V77wX3QN8dOO2XfumXOh1f3yRrlnJP2Y97njaJQmHVgHybcUOp6913
332jnTt39muF6efLPI0vvOsZzuXtunFhscj5wn5H7kr9iM+xPz7ykY/s7h1+
dtoo2eQpMCSTFQqrhNa+xjOb/gv6OjAns/adcQrveMc7ervAIv1+C7sj+zpj
D5S54KnLL7+8W/dDlmKOUb9n/kG/xx8YblMu28w6WqGwSOTzPkku0sYoZ/Hc
s/6tPsFnH//4x8fksrTxFhYP76NzhkBnR5dPm/ojHvGIPs7kK1/5yphPu5xX
8nFhFTGUNyLnVn3V/Pz444/vnvMDDjhgzG+H7eabb+59HLZizbMwG3JdOG1Z
1157bcdT6bPA//DVscce28WuCP3/RBvjXiisCob8U/zM55+4AH1Wzj777D4G
lNef//mf73WMpz/96d0c38ahFRaDVm8zXhm5SlvVwQcf3K8Hcs+OOuqoXtfP
+5RxhGCZcTWFwqzIWIUhH3uebXU93rMxP2O7Uq9AzrJuJuMElE6xPKTPL3Iu
94It49exXR133HH9MclPctM8uT0KhVWEXJZriHAW8zjzNbJVjgvGCTJXzv3w
XetjWvbc6WjzBeUc4Hfo4L4np4bzhq+uk8BV2qdqTaSwr2KIr3jemZ/RJzIH
EmvmjhNyaBmfKMqvZ360Ol/q7+m/gFxL3xuLgL1KnfCMM87ojzfGZm/FzRQK
i0Y7Zox51l4iX6VPD36JT3rSk/pcasL3pXNMR/qog/RZgHfUAbFR5doHvgr8
z+trX/va0Ve/+tXuPCnjVv8X9lW0fJUxkeZ21geejTyMvj/kkEO6Y1Kuqrl9
PjAnmPcTjkp/EXyrWPPTVyHnjC9/+cv9frl26LkKhX0RG+XUMkcavvDE+Kev
D/oJdvn9999/bG437rawMeB4c1K3oD/p15Rn9eHlHmhPh6dY3624zsJ2R9pv
0fOYt9VLyP8md/GKXQVow6pxMz+Qq5BlyUWGHIVMi86nvcrYZWIB9VnIfk5f
0orvLGxHIFcBxgdzORyWNni4ivUp1gwPPfTQikubA8qkvKpPk4MMOTb1vlyf
JYeZuvpQnoW9lVu9UFg0NsrnnDkHncvVXfR1UDdJ/1LsLTVmZkfamogFVH5t
+xe5ynzfmaMBWMNEVOxBYbuitW1pc2GcIQOkPYsxZY4H/BrB3s6nuDeRnN/m
xBTy1dve9rauP/VXYE3DvDDksc4Y50KhMBnJWY43dBh0k4wzxB/IeDZs8Tfc
cMNYDRAwVMdgX0Xa8dq6pmkj/63f+q3eTyHrd2KvOuecc3ofkcwNVLxVKAyj
1RGzJsU//MM/dDJW+lubk4Y1LeqzII+lTLHddMWssWy9bj+3r1Kvhv/lKuYE
kNxXXFUobIzkLDdlBta1XvnKV47Vy5W/GHvE52KnT1ljO4y5lpftL9YAsUE9
7nGPG+uzjLM5+eST++Nd5xBVe7tQmI5J9nlhbofM96eeQx0L/U+3k79D5m7J
GEH8bOUpc8Fot3rVq141WMMt3283GbVQmBdDfqXM/eYrZRydcMIJ3fq7taS1
H2Pbyrqs24WvAPqfNUrhmfRX15dNjjfHmPFQ6beeeaxqDbBQGEc7Jtq6im1N
WmQJuIuc8MlVOR7f+c53dvtqw9mXYS4X++3WW28d86dybUIZK3Mn6seWMeUl
VxUKk7FRzVeRtTWVv9BlTjzxxLFYQ+wyrNdjz7ryyiuXfSl7Bem/hmxpLaLW
Z50+IYbJ/bNGc3suUfHMhcLWgvUtxiX5L1OW4PWaa64Z83NUVhuqjb3KSNt3
WxMecC2sN2TuYvRAa6fxPz5YmZsaFB8VCsuFdSy0ZVkbzxxz559/fref9UDX
bd0rOWUojg+d9/rrrx9bf0BHzvwWqQMC+Lu4qlBYPhyD8FLmGXA9DDsOcYfa
mIG+qOsyZtHZ8DXQTz1zS1933XVdjkPzFaMPGxd4ySWXjO65555u37vvvrt7
hefWjbMLhX0FKTede+65u+VGcTMnPHbldYqXbnVX/TV4Peigg8bWGbBRWW+Z
+BrlKvzc5easCVkoFJaPlJUuuOCCsbwO6EXIG4xh4qRTzloH3kpdznUG3pun
WD3YeCXseGeddVbv/zG0RjpUu6tQKCwe7Toi3HXRRReNreXnGiIyCUDmWIcc
pXLLvffe26+PwrvmXWUdkGvjlevFnxaeQu/TVwReVpeEo4qnCoW9h7TrOEZ3
7NjRc5ZcpY7IK1iHeB3zT8FVcLM+65mvyv+pRSsHe22ZkzVz8FQ+40Jh+Whz
yViTFZjbIWPm9HUgX906yFfam5CJzF2sbz/XYh1T5C8hF3l9+q/5f/mtFwqr
CfP+pSxijIo2eGB9MbBsH29t6MAYb7mFV+rC45vBph+odnY+k6va/FXrID8W
CoVxkNvBHCpyFz7gyCj4AiDDyA/LXutvfSrIQ6V/Pxu+VelPxntkQ2s1WnfD
NUNQul6hsL5AbsK+rnx14IEH9nYs+Ivxb86t1KWW6Z+V+auU7ZCrtMHBr9Y7
02cBrjLGOe1UWRO7UCisD3LMEsMiZxmnoryFbkg+mvaYRUOfirRTwTesceqj
gFylDyicRZtF5imEu1K2Kh+rQmE9oY3Z2juZDyrzlpLbAQ7Q12kZMBex9qes
A6gPhu3Dj5/9U/8TrW9HoVBYL8hTjHHfM9Yzvs66C8ozF1988ZjNe5FIXoFv
lPnSb931TNoF1FOtD885eD+pTmChUFgfZF1ixjZyDDJU8oFc5fobuuGybO/4
3MM7tIFN3/UDDjigb8+xxx7b7Zv1BNvchvAY+mWtCxYK6wl1rPTTMiYPPkq9
UG7wlbW5RUM7v7pf1v5R1jrjjDP6+hvKVvBS1ufItYH0ay8UCvsO4AE5wjoy
+f7SSy/tOWFPa7S28S/WVxSuUWbco35i2N2tV5b+++uSW6JQKGwd9FtIn1L1
MXzHkXuI7RnCLOuI8ouykLnoQdZaZr0SfuL39FvIuoCtT2nlhCkUth8yVkWZ
xvpXbsTBkPdB/YqcB/PwBXzY+pxfccUVnd4pN8FXmQMHpG8C65pp/y9dr1DY
fnAdTb8nbEXasOCtlLvIOZw8NW9OZfy/4B3quxoHiF8Vv6XNDLtVy0u0TZ5L
+3rZ1QuF7Qk5An4wH426WsbxkM/Tuqyz6IOp/yGXkVO+redjDgm4Sv2PNcPW
R4H3WRO2UChsL2jLhhvgCu3p5JFyje7ggw/ufct5Jb8y9ZNnBbzG/lddddVu
NRN5j2zFb1lji3jHRNYLGqrPWCgUtg9STpIL4IcLL7yw5xdtWqkjznNu5Snj
ang1hxW2K/gsZTZztoOsYSq2U/3qQqHw/5G+Wda8UofDLq7eJtfAV8hDbNMA
/xmrqF1MPZMN3TNrjmFPm5T/M+1VxVWFQmEI1G5Qf8scVKwlIiO5jieHyHXI
Sqz5sX/a7eEvPkPnLBQKha2CPpqvf/3rO26Sd7I2KfnUjZFOHwR95+U33rPB
V8hVhUKhsJVIv6mdO3d28pJ2eHgI27vxyO573nnndfuoP8Jb+qDCeaecckof
q1woFApbBeze2rqRoeAiZSzlK3M94A+PjofOKKeZ+0H5Cp917ejrkD++UCis
D9p6M3AW8TnG+7V1apS70PngLW3tyGW5xsf5yke9UChsNeQVY4zhmjPPPLOv
A0/Mn/zV1pXWfgX09arYv0KhsAikXJVxxrw3dgdOSl+H1n89fara/HyFQqGw
VTA/le+NM5R3Lrvsst4+ZQ6rlK1Am4fG/DSFQqGwlVCHSx9OZCx90eEkfd/N
qayt3ToRIGvvFAqFwqIAV+n3LtDthnKB+pq1t3jNeGogDxYKhcJWIes2WHsZ
7jKmxnrw2NSzhoU8xvfGNJtrSxtY5YMpFApbjZSr0OngpYyvcW2Q3MmgjZEm
bkdOg6/gvaq3VSgUFgHt7OhwWUcHTsLGjo8VfqTITa4FGm+IjJU+DrzXjlU1
twqFwlZCX3R4SN9P5Sa4Cs5ijdD1vsy3h6096++knlgoFApbDWxVcJFylXIT
r3AR+WaUqXbt2jWWVw/ATcY7c0zauAqFQmErYR3TjF12PZB6y9qhWPeTq8jT
7ufwnRynnMX5lNUKhUJhXhhro1yErQo7kxwDR2lH18Y+C8wB6Dqir8lfQt2z
1g0LhcIQrE/vezmD99ip2A488MCxuhDYrbCVz1OzFD8IY6M5nhph6bulX5Zy
WdWVKBQKLeQE/QwAXCGP+CrXpK18Fj5Bn8x1wDbHDLn+eI9+2MZVl89DoVBo
0cpY5mrPHMj8j91J7kFnmzXfHvYswP5srW6oLzznh6taX/pCoVAA1l5GtoJX
9KdSrtJnAc5SnsLPap7cVVlzR7hmyLmV3eRIfSIq70yhUBgC3KAdHB0t/aWQ
e5R34LZJ9WuG4L55jDWbsdm3tSj0QS0UCoUW8BDrgMhT8JK+oAcddFBvX1cu
Yj9lHmOg5wH7Z5wz75GnzEPDK7qhtq3SCQuFQgJOMF7GmjeZzwrIUeqA86zb
GeOcx8BbaS/z91t7WflnFQrbC1nTQV8F675j+1a2MYeCdiU4ZBlAv0TOss5O
2rXSP4s2K5tNq1NhzfqqW18orBcY59/73vf695mDXZvRYx7zmDEfTmpvwQnL
sHenPwX2LHRS7O/G/yjruRapXLaRf1bxVaGwvmBcp2wFZ2X90vQpsDYEWMZ4
T1kJTsr8M3CVNS14z/eZi3kju3/xVaGwfsjc69jL5Sr0QOxEyi9syFXKX3DB
suzd3/zmN7tX+AWdT46SS42RNucfW9UCKxT2PcBX5loH2LS1a7Pha2Vu0NQV
lxkLk36n8qs5ALG7Z/4sePbb3/72bscVCoV9B8gkJ5xwQu+vkHms4KqsO69c
tQzO0kYG99gGdFf86H/xF39xN/8s+IvP1PVK7ysU9h3AAehbN954Y7/2hkzF
ehx8RZ1AfQ58BXujHgS/L/dg16IN2LK0veufpa+D+xdnFQr7BuAf65qmXR3O
Qm7he23e1ulaNrCVKVu1sYO0Dd0QjtKOlf5ZxVeFwnrCOECgbef000/v19fS
ts6Yv/rqq/dmc2cC3AWPPupRjxrTYfVt3RP/rEKhsHegjXwoF8uOHTvG1tf0
DUXHuu6669ZKJuF60F2RD7M+j/yVNe8B9q91ur5CYbvAMapOxdjeuXNn73/Z
1jS98soru/3WIf9B+riiN1pD2ms54IADetkRO32uF2wkZ5UOWSgsH+bZc2yi
E5100km9PwB2KuUrxvdVV121VN+qrcB9993XvcJb+OqjG8K/ylgZ/2juh2m+
pG1MY6FQWA6Uk9CBTjvttDHbjuMYmcR6pmBdfJfglvQNlWfNp5z+8K1/1kb1
DYuvCoW9B8Y09qqUO7TtYPN5wxvesJtMtQ71Sm2zNVZ9z/aEJzyhu970KTNO
Wj7KPM8JZaxCobA8oCMhK8FV2KOH/Bauvfbaft+s57BOaOUh9D2uu/XPQjdM
/yz05I04q1AoLA+MuVe96lVjOpG1/ZA1WAcEyCPauNQF94ZP6J4g63shR2ZM
JNdPHnjzyytXaoOHo+WsQqGwPKQ8gC7HGDz55JO7calMgX7ke+WqfRnmkj/0
0EN3WweVt7PuD5hki0///kKhMD9yLb/9/5RTTunGpGuBbsQzX3/99XutzXsD
yFDY4Mmdlf5Zcpa2Om335s+Cy8z5kEi//0KhMDtc/0vf0FNPPbWzURkTqA6E
fKF/1brZqPYU6XcGP6kbY8+y1isbOnHykHNAylRp66o604XCfNDO7PyP/xF5
FrSnZw5O5Cz8q7Qzb5fxtmvXru7V2hmHHHLIWF4H+QtOh+szf1bKUMb0yF/b
pf8Kha2EeTUZi8hVGe+bNbAuu+yy/ph5a9esM1KX87pTrsr8WXAY/qfIUMif
8BbH6O/e1sUoFArzA87Ctp61TPU7Qn7Att7aW9Zl/W8zkFPgcvU4rhsuwj8r
+yv5neOSm+jf5Kd18v8vFFYFjBtsxchVQ/5VbG984xu7fXP90BoT2wWtbGT9
H2Qr86maR9V+Yx91yczBCoqvCoX5gQ3luOOOG/Ov0mcBOeEtb3lLtx/yhePN
1+2gz2TsJGBtos2Paj541ybS5+PMM8/suT35qny2CoVhsE7l2GDMOG4Yd3AV
40ybOj6R2pGJ+y1sDPoS7nnsYx87tjaBzGXNRfxtRerQbYwl/J85xgqF7Qw4
64EHHujew1WXX355b0s3d7nyAb5GhenQjg7XwO/UAIKrtP3pn3Xeeef1uiH4
zne+0726NtvKqvBWrR8WthvUXTK/HLodOdezppU8BX+hG4J1yF+1CjDPMxvy
qXqh8YbG8ZAzzPki7WHpk5WyVfmTFrYb0tbiWGBuT3sLsgC8xfhCPtC/ocbL
bDB/ljb1gw8+uO/PXDfEFk/MgDzV2rCQpzKnxXawDxYKLe6///7uFe76+te/
Ppa/ythAZADWB7eLz/pWIvU2fdqNN2QucK2VPqa/X/3qV/f+pOqC1mRM+Wqj
nICFwr4In39zZ6YOmLxF/a2MdwPaWAqTYV9hR8/c7rx//OMf3/Uxenb6itDX
xx577Ji9nWPSx6H8HQrbEdqg/v7v/77jJvKRtz5WxPCK4qo9g/qz84P+WQcd
dFBvv2LTLx4b4YknntjrkiD5q2SrwnYF61JtrJt+jdhaALymXqMNJXNuFiaj
jdfJ/Mq8h7NSH8yaZ9RD0wafx5XtqrAvQntt5gLQXgX/oAPmGDG/L+vszPXG
LW+U27ew54DLuDdPetKTep8R9XA2fB9e9rKX9ffRe+d9adcLy8+0sM7wec4c
CwB5Cdu6sW3IVYwTxgtcxTogKL5aPOxT5gf6PXMqu+ZBTgzrWHA/uH/GIHJf
W18s71mhsE6Qo6wzBdDjvvGNb3RxIvpYZ51A7L1Cv8Qhriru2hok3zhv6E+C
zwMbMu9rXvOaXr7yODApf1bxVWEdkX6d2J7gq/SvJv+4c/njHve4Pj+T+Xkn
yVbFV1uDXLugz4kdMBei/u/6apEjA3hPUq7if/xNvC/lH1dYR+R4YH5Wx8hc
AczpxLhp/8i5u+q7LA/KRPg6aHM3XhoZGF3xiCOO6Pah/5GZ1QvbGj7l81BY
Nzj/Yvv47ne/O8ZP2nbZ8F8EzM+uPfG8T6qbXvXUtwbKvsi8WeuMeeNXf/VX
O7mK+9TWZD366KPH/Bsqf1ZhXwG8QjwgvMR6E/M0PlXpZyX0UcAW77GTzll8
tbVo89Kgkz/mMY8Zi9kh57RrJOQku/fee/tjyj+rsO5gzoWrnJ8z1yWcpX+V
NqtZbbTFV1uHjHFSps049F//9V/vuarNQXbaaaf1/llwVMYrFAqrCOP/gflA
fW6Rk5SltLFbM5335a+w+sCf9+lPf3rPVcw9WY+I/FmZf6ZQWFXk3Jw2DGxV
X/ziF7u1Jv0Q0QVZc1LWevvb3158teJI3wRipYgzxOauj6/zzute97pen6y4
g8KqQnt61i+Aw/CvMs4DruI5zzrxt956ax/3X/5VqwtjcIiX5j6R809fUvPC
u8570kkn9cepVxYKqwbmU+dWdEHsVTn/ph8P23ve855u33YdvPhqNdHmRWbu
YY2EdRN8e+Wum266qc9NViisIrKuCpyFraPNC+o8zPbhD3+4zxOQeS/Lv2p1
kWt9ylvUCst4HbgKcC9rbbCwqvDZhLPMC4otVhsHchVzMZ+hA6InuIHyr1pt
ZH1tX33/K7/yK939fd/73tfti81SlA2rsIrweWbeVaYyf3HWM7jlllvG8u2p
M5R/1eoj69P73nhQ5iDz+8BXrreUP0NhFaHd6hWveEVnp9JnXZ2Q7V3velc/
L2demY3qqxRfrQaG5pWUj/0uc2OlfaCwfGS8rmPM+2V9NzEUP+X32myAtma+
Ywynzp/j2nufx9KGnL+y9gLf+X4rYyLkl6zHaUwyNQLlKHO+IVfx2Qc+8IE+
DwnI6yy77L6P1g/Y8eMz2+Z2yOP8LOtfKMv5vc+TdRPz2cz/0wcWqK9mfjZr
AvndutcrY50e/nCctrnKGMt8n/3i9ed6v/sDa8NpG8i1GPut7Xv7kT6Ww/K+
tnGnm8UQ733rW9/qXl/60pf269muc/v6zne+s3uOco5u660Utg+Yu7B1ffzj
Hx996lOfGn3iE5/o3rt98IMfHH3oQx8a3XnnnaO77rpr9OlPf7rb773vfW+3
TsNnn//857vPOQ+f8f0999zTPUuMHcbMpHw2fE5+yPRtZux5/s997nOjz372
s107ho5fByR/OL7+4i/+outf+o9X+pdX+v8zn/lM955+/+hHP9r1Jxt9zP8c
yyt9wufs98lPfrL7/u677+54zH4XQzKJ7WI/2kX+c85NGz7ykY905+WzrUDW
PGf9z+fhmGOOGYtftp4dr/iCJn/Cq6UfbE9w/5m3yAWYPnjaOvGRx5Zg/MPQ
lnFc5qBNOynnoxYZ8RTqHvrcM9+39n9zftE24ozS34b3mX97HaEcxLVbByHX
czPntf1uH3P9eS/a/duaMMcff/zo7/7u73bze7HPs2a4uPjii8d8CHg2zjjj
jC259nZ9mpww5G7L5838uTx32NZzrai1d1Tuye2DvO/5zPvM5DgyL+BQTW8/
z3GkzUF/GZ9/6pF96Utf6n4zcxnl/Jlc5Pkyv1Huv45IHStlCvoQm01yRXsf
6GP63XzY9EtbD7ztM/b7kz/5k9Ff//Vfj9nPMr8jfMaGTn/++ef3cXm+UmN8
q65dUC+F3Li2PWtu8j9ylTzb6sBtX67z81CYH3JP1uPJfKa58Sy14yifOXNy
OVayHhkyPq+Z4yNtKu18n/FiyVfrDm19clXKqK1cxX3gNcdzW1ud77wn5lmR
7+xzcm/S73CAck7a48UVV1yx27295JJLNn3N6n5yJrq+Ps35DHG/3//+90+0
T7V+DKD8Cvd9aAfgtR0Hjhd0AcYDz7/jRXnK8cA8zqu5aN0vxxSyvfO9cUPI
WdqFU74CfI5N2pq8qVu262jrglx7U7bNvpZX+D/z+rpl3v6UNx3zyl059of4
jftN32a8HlDGuuyyy/pjPAcy11agtbe/6U1v6s5P3gV+j9ebb765l6tsU67x
0N6Wr9bZPlCYD8xXWf/WcXH55Zd3OhtzV7ue7vPh9wA7w4tf/OLRYYcdNjr8
8MNHz372s7tz5hyateHYfC7Je9PagmkXPJm5Q3i/zr40bQ30Vu+D6+GGVl7I
dbFcxwWsr7G29tznPrfLL/usZz2rzy9Ef8uD6pvKqOnTkPPFkHyFTWuzSL+J
vD5sVLYPmcs+4pmzjZPuOedcx7mrMD+MZ+dZMP9M6oRnnnlmv29bv6K1c/r8
scbn/z5H5m/W5y/1yRtvvLGLvxfwl88mr0N25GzHuqGVIx2nzBHKR8oy0/y2
W1izzWOz3q5cry2b3GhDOTs47tJLL93NdnbhhRf2Omz682X7fJVvUg5uOcWc
k4B5jueAdci0abJP1UcpiOSe1lbLdsEFF/T7ts/NLGNIOYDnlxqKqcNok+G9
MRgt4Dw4Km1qbJ43c4fYnqwn5GvrS7Y35+NF8pXHJP88+tGP7uyJ3N+sz0f+
Ic6LXJu1KjfiK+Hchb3eNspl/j8kF6nL5f/OmcxznGOSf1XJUIVF8xW2c+Uu
nl/qKzFWXMP3N1lv9zlun8u0QasbJlLuS7/Tdv1eHlOf2lvz9SL5Km1DrlvA
Aax3pL7vq+uFrU/9JL6SX9qct967zGGb+yhzA2tjDrXZay3/qsIQFs1XIP1l
zj777O68rh+q51177bX9uc27Jhw3OXYAz3M+945PfZuE8z7IMbS3bGCLlq+8
duRVORuuYb0j7fT0vWt+HDOPfEXfpwzH8e19y/fJPcpNylUic323/lVlSy+A
ZfCV/OF6lGOFsWme+ec85zndvml78bVd22L/BONSTjKuI9GOG2Wr1u69LCya
r5BxUnZEZ4O38r7an8973vP6/kl9bhJfMSckT/Fe+bmN85E3rXniOl/2Qxt3
P8RL8lvJW4VF85WxE4m0/zoeWL8CQ3yVYwZdUn+GXO8G5JkkNiX9mNjwT2XN
6a/+6q/6NgzZypaFRfKVcYOAe6rM6TzhPZav8Jnw/mTs4DT5CsBVX/va1zo/
qZe85CX9OfH9Yj4ij8Kf/dmf7XbdopW5Es5xbRx/YXtjGfJVcgN2jDa3vFsb
Y+v5k9fkImUBxsyxxx475kvqOFTX1DcDvx58vP/yL/9ykEeXhUXLV/Q391M5
iPU21385fxvfA9qY6kl8pZ8cMY3mU8+YBv3u9ttvv36dmbnobW9725j/QptD
gvfaFuXcVk6s9cHCMviq/S25RR7Rt3vo/OqDxqgYCwTwNdU/gs+Rvaif0vqx
+hv+HjUb8ffZW1i0fNVCOcZ72sZ6gln9GcAf/dEfjfnQ5Vwid7VzBffsqKOO
Gn3lK1/ZLe/DNPtUu7Zb2L5YNF9pn3A88NrO8/g1Mh+LofVB61irb5CLoG2r
49B8Sa3POMcfeOCB3XvWJ7/85S9vouf2HBvxle2Er9IPfk/011wDxVaXcYdy
zC//8i/332eb+H37Wnn1nHPO6XxR+YzzOBfQ166feA/4Lp8nfw/O0sbY2tQL
hWmYxlc8txlnmvaRtDW1z1v6zqRv1Ve/+tUxTuE9MhHrhhmHk7AtrG8xr8tD
1p1LvZK5/2Uve1lnRz7yyCP7seacr76i77exdCD1j0XmX52Fr5Bvcl6YNT+m
fe090YeDGjNyj/0Hp9Dv3pu8j+eee+5Y37ERQ6U8Je/R9/iovOAFLxi98pWv
7GIanvGMZ+xm10/5dufOnV2cM0jZaW/aFAvrgWl8deWVV3bfD+W8NH5r0jgy
51X6PhMnwu+g38E/xCbyO7fffvtu49g1oZan2LSdsD3lKU8Z3Xbbbf1vYtvK
mpnYTlL2Ms8N9ixkhqH+2Ft8ZYwB8TD2b2vD2Whr4XU885nP7GWhjG0itxXH
YZfPa6ZflGtbO6NyFdzkb8KH/p4cSQ3fNo5b7kpuqnW/wqyYRb5q/Ywn+R/z
nA49e8pLzNk8/64PMj55z5zd6iMg7S4+8+iNKSM97WlP6/yzATE9reznOcln
Zx1zNnkSLjQnrz5Ei/bLmiZfsRFv3Orfs+QfyFhM7wd5YNTXvMfKWnJLe25i
BW2L80v6xr/jHe/o9svcDtzDvH/o/uibqa9zD7h/xnnl72YcTqEwhGl8xXM1
q22hlbWQc/RrZi5u52t557rrrtttbKbPOu1q20b8NHEmgN+Qn3j+GbPKV2kD
2rFjRy8bwFe0g9fWD14sav1wI76ifbQLvmjjNX2/0dZeCzk75Rn6O/t/KD8M
/cXvXnXVVWO5a5JP3/3ud+9mA2h1uZTVDj744O44uMq2wMd5bNU/KcyCaXx1
ww039LV2stabep41KvNcvGJT/cIXvtD5Q6l/YP9obRnocjkv+5o+6cpBvGYu
O9qQnJLHmHNX3mI/NmSytjbUNddc083tcuui16KmyVe0j3WO9N9sfS03wvXX
X9/lY1GGzOuVr5/61Kd2+2Yu/MyJwFpg5gxKuU/QZ/ZvxttkDkDimJHvMm7U
9Y/kPPhq1usrbF9M46u0uWpfRR8wdtYt89f6fdortI2nPsjn+PGkf2PWPgDa
r/wdz5F5I4TPe5vXLb9PXwfOQ7vavE5Zf2MR2IivMq4y5ZtcX5i2Ice0a3Nw
j5zPeen3STUoaZf29jwH90vuzHmqvS6hLQubfuZFMy9q/n7ZsAqzYBpf8Yw6
NzrWh9ap22eb55LjGCPuI08pb1HLAGRcjHpB8sxQjjrGU+Z+ELmGr29jzv3I
LYz79C9lvSp12UX7+2zEV+bWlFtSPtLmt9GWx+lnLod575B5kd0yNrytX0Te
syEubGOb1LnbekhDa7y55qHfl/e7fNcLs2AaX6WvjvqFW/rzmPNlUt5xuYox
xD7EcMAzGz3n6nGZSz7zzyTaOn5tXA9gbGhHts20H/uZ+m7ry7gITNMHucbM
pZq58r0fkzY5yXXA9OFku+OOO3q7dvqm2D9+bn5R85Tx2xdddNHUa0s7ZF5n
+mrYzqG+KBQ2wjS+gl+G5CrHVet/mFyV+Y/lK+Jh5p1LPae/z+u89XrdHxtz
yim812+7Peei1gmn+TPwv7WNk/dTzpy06e/vfVOOpP4MyHpqAF5v1zqG+Ir3
xVeFvY1Z7FfIVdqd1FlSP7EOTo4V7BXY15///Od3z3lrK6FG76zrb9uJr7Rf
mS8/+R89dpo+yPbkJz+5y41MnWT8Mtt88bluClyXyPYZj6N+mv20EYqvCovE
NL5iXRuucU0wc0Za10Y/H+0Yk+qWqH+0+Y2mYTvxldd39dVX7+ZHMsv62VA9
Z5D5Drhn6X/Q+iYkX2W7iq8KexvT+Oqss87q953HDyv9yz02c+5m/oBp2G58
xUY7jYNq8wlP829Pv12OxU44zdc0OavlK9uUsaSTUHxVWCRm8W8XacNmHrcu
SeZQb8dPq/Pl2JvVR3A78ZV2K9bnlEf1dZvFv505IHW9jXzGuW9DfgR8bj8V
XxVWCbPy1aQ1/nlyIu/pM7md+MprRb6ZdOws8lUrkylnuZ+x0MVXhXXCNL7S
nzmfJ8fDpGeslbPasdPmYZuG7chX+F1ob5rHRyn3z/yr7XUN+Xp6XPFVYVUx
ja/wTW71hrZW5xA/5dhv16c8dtb8IduJr7Yiv+hWtG+WfMhDKL4qLBLT+Gor
84vuKYqviq8KBVB8VXw11L7iq8Iqoviq+GqofcVXhVVE8VXx1VD7iq8Kq4ji
q+KrofYVXxVWEcVXxVdD7Su+Kqwiiq+Kr4baV3xVWEUUXy2fr/RHM2bA8Ws+
Md4bj5NtWFZOO/zg8RPOfDbk3SCv8Sxo/ez43xxeWZuH77IvCoVZoN+mvJD5
QHNONQelWMaciM+1z7h8xdgBs45fxryx1tTJMl+Xuf+oWWYfEO8oRyyCr7LP
PD9tMC+o1whfyFfLzr1JX2V+UXkLn/tpaJ8JfYs53nzOXitoYx8KhY1APKxz
m7ndMkcoedKte9Dm8FwWsu6BHDNrjnX4J/3xka/kK/OLkjPHa5oUU7eVgIPT
t5/roe8dx7QJfayVZ5cBYxUyD6vPwiz5+hJZZ9dzcY0+Z6Lq4xTmxa5du8bq
8/mcvvWtbx3Ljw4WVedqCNTZsVYquUppF+2cJVdBC3IXYBciJ17m8eSzrOkC
jAdeBLKuBr+ROdeVa5ED5TQ4hBjAWfPvbBbcb/okdTf6bKjGR4uhuHba3tbK
4JqH6owUChshazEM5R6Bx8CQHrPMZ8ycgYA2Z+2ujcBYYdxnW5N/87rgYXTe
RcqPeW45t+WhzFm8bFk2f4/+MAfjvFxJ+7k+ZdWhawQ571TNicKsyJwJPGNt
LPJQPpll2Ejbui2ZP3MeHcJ5X1sW4JozJruN6d4TGW6WdojMiUB/K7e6j/Ww
bN+y6vOljJTvZ+nvodwPPkt8zjX6f+qL/lahsBGGnpEhe8ky1s2mIWt9bVUb
JtnWMxfqVoP+zRzRqXsmhyV/LsuGZXvS5pfz2Kwwl2OeQ77lWrPu2rz5hQrb
F8lX5lX3+XFctWOa12WuPz/wwAP9+8w9Pst8P4l7W05IuSvH6FYjf0+0cpVc
uVG990Wh5RjbM+v9buVHof7u92kDbfMOFQobwXHRPi/tmG25bRlox7JIDpsV
0+SV/GyR8lWhUCgUCoVCoVAoFAqFQqFQKBQKhUKhUCgUCoVCoVAoFAqFQmF9
8f8AX55fDA==
"], {{0, 241.}, {300., 0}}, {0, 255},
ColorFunction->RGBColor,
ImageResolution->72],
BoxForm`ImageTag["Byte", ColorSpace -> "RGB", Interleaving -> True],
Selectable->False],
DefaultBaseStyle->"ImageGraphics",
ImageSize->{50.24609375, Computerized},
ImageSizeRaw->{300., 241.},
PlotRange->{{0, 300.}, {0, 241.}}]), !(*
GraphicsBox[
TagBox[RasterBox[CompressedData["
1:eJzt3Qm8beX4B/DbgKIoU2ggpUJEaTQ0q0SaLkLRPFHppoSkLs1FkwZCs1IK
GUJxRUJlHlKaKaXRECrr3/f1f1m2fc7d57TPXuvd+/l9Puuee/a4zlrv+7zP
83t+z/Muvs3um+4w57Rp02bM88g/m269z5p77rn1vpst8Mgv03ebsfOOu22/
3Qa77bX9jtvvuco2cz3y4FmPHPPMMW3a3I/8rAKBQCAQCAQCgUAgEAgEAoFA
IBAIBAKBQCAQCAQCgUAgEAgEAoFAIBAIBAKBQCAQCAQCgUAgEAgEAoFAIBAI
BAKBQCAQCAQCgUAgEAgEAoFAIBAIBAJF4i9/+Uv1u9/9rrr77rubPpVAINAi
3HvvvdWFF15YzZgxo/rsZz9b/f3vf2/6lAKBQAvAFnzta1+rXv3qV1cLLrhg
tf/++ydfIhAIBG6//fbqPe95T/XEJz6xWnbZZavPfOYz1cMPP9z0aQUCgRbg
sssuq9ZZZ51qjjnmqLbccsvquuuua/qUAoFAC8B3+MAHPlA9/elPr5Zeeunq
lFNOqf72t781fVqBQKBh4BjEEssvv3z1tKc9LcUYt9xyS9OnFQgEWoCf//zn
1dve9rZq3nnnrdZcc83qm9/8ZtOnVCT++Mc/Vtdcc011xx13NH0qgUBfcP/9
91cf+9jHqiWWWKJ61rOeVc2cOTPG9yQgL3zqqacm3ubkk08O7UigePzzn/9M
+cxXvvKV1eMf//jq7W9/e/IlHnrooaZPrTj8/ve/r3bbbbfE7a6++urVpZde
mq5vIFAqcJJ77LFH9djHPrZ64QtfWJ177rlNn1Kx+Otf/1p9/OMfrxZffPHq
KU95SrXvvvum6xsIlAicJHvwspe9rFpkkUWq973vfdX111/f9GkVjd/+9rfV
O97xjmq++earXvKSl1TnnXde+GKB4sDv/c53vlO97nWvq+aff/4UM//iF7+I
sfwoQUsmXnvFK15RzTPPPInz/c1vftP0aQUCE8Kdd96Z/AW24dnPfnbi08I2
9Ad33XVX9ZGPfCRdV8fRRx8dGvURhDW48ygB1rivfvWr1WqrrZbWuLe+9a3V
z372s6ZPa6jAF+OTPeYxj0l61O9+97tNn1JgQLAW/OpXv6q+/OUvV6effnpa
ez/xiU9Un//85xP3b/1oc82jGHmXXXZJMTI91Pnnn189+OCDTZ/WUAFXKddJ
h/rkJz85cZWRMx5u/OMf/0ixJHtgzV1ppZWq5z73udUznvGMpBvAR73pTW+q
9t5776RFpD/0njbhgQceSOdP64Bjf+973xsc+xThxhtvrHbfffdU6/bSl740
1cqHHR5OuK9ql7bffvtkE+acc850zD333MmHdMw111wp9+0xtY9y4XLgbRoT
P/rRj6rNNtssnWPWSZYSF5WIWbNmVWuvvXbKH1tTfv3rXzd9ShNCSXFzk/jl
L39Zbb311kl/zAYstNBC1YYbbljttddeqUeCg45ggw02SL7EtGnTqsc97nHV
Flts0ZrYnvb3oIMOSv6OGqwDDjggxUKBqcOf//zn6kMf+lD1hCc8IflsJ510
Uqtr3tgCPqZxce2111aXX355Gr/GjsfDVvwv6GaPPPLIauGFF04+wote9KLq
gx/8YHXllVf+Fy993333Vd///veTz87HYCO855hjjmk8znBfL7nkkupVr3pV
Oi95zauuuqrRcxoVuO70qdaLN7zhDdVPfvKTpk/pfyB3pZ/gxRdfXH30ox+t
3v3ud1dbbbVVWu/e+MY3pnXQ4+zFn/70p6ZPt1W44oor0nUyr57znOdUhx56
6Lhck7gTH8XHYE9wEvyPJoFjkM9cYIEFUn3mUUcd1aq4Z5hhfTnssMOSz2a9
cO3xl20Bv8Ba9/73vz/ltJxnjpXz4XePv+Y1r6mOO+640HT8P+Qhjj322OqZ
z3zmhNbdH/7wh+m13rPYYoslv7KpPkx8h6985SvVKquskngH/EP4DoPFD37w
g2qTTTZJPIS1xprTBl/dObAN2267bVo3jFd1OGIhvMnGG2+cfE6/exznZjzj
4NWpjjr4XHKBbCgtERsrjpgd+GBiEj6E977rXe9qzC+7+eab0/c7/2WWWSbl
3ZqOd0YNeAjXHW9tHu65557VDTfc0PRpJV/XXH/qU5+a5j7/WI2eOhJ8/I9/
/OPEsct5vfnNb07cFRtCj8+Pvueee5r+ExoFnQOO0TVZcskl0z3uFd/4xjdS
3Om9r3/969O1HjT4LOecc04al2ILHKoxERg8rDViPHlluohPf/rTjWpW8aSf
+tSnqqWWWiqNUef04Q9/OI35Tv2O3+W+rJVsiTVPLEJnN8qocw8rr7xy0kT1
ClyleM17l1tuuaRDGjRwz/JqdJJqAtzP6DfbHNS8rLfeeinOsO40yUupxdtu
u+2S34A7NfdvvfXWMV8vFhEnbbrppilOpa+z3tx2220DPOt2gT5gjTXWSHOc
XkA+u1d02ofPfe5z6fFB6bHFM0cccUTilaxZYqPQ8DULsam4E58ljsdt4Qeb
gLgh57Pk2/gSsxuTzlU+LsfNfAg5j1EFnwqv5BquuOKK1UUXXdTze3Ney3tx
PeI5XMBZZ52VrvEXv/jF5OvLI/TbXvBb2TL7WFgf1l133erb3/523z4/MHmI
M6dPn558iI022ihx2U3gjDPOSHyDee48rr766p7eVx/Xiy66aOLeRxU4Wv55
vhYnnHBCT/65+Ynj8R7vxQ/rL/T1r3892WxcgL4L/DvridoN98drcIeP1lbw
HWl7fY/48sQTT0x95ALNQ9xvbKjttA7LfTbhQxjL/EraX/y1PGwvwE/gKo1r
eygdcsghI5srpxujd6KbFMPjnT02O/ALdtxxx3Tt5Q3oFtkMdX377bdf8kVc
W3Ecff4KK6yQ/BRzGleM22Sb8MPZv+gVdU7Sd4sRoxd1u2AcWHdyvvN73/ve
QL8f3yj2ND6Ma/sa9MqV2hNFjoN9cP60U6OsmRJTWOtdj1VXXTVxfOPNV3Pa
ei2XmPMeuGrvMXfx2GILGkzaKbaBreDn4Yn4HPw344fOKuea/vCHP6T3zy4W
4TvstNNOyaY57y984QutyLUH/gM+hHot9bN5H8Ne8ub9/H5+C/uQ/Ydev79u
H+imrD+DPPe2gc/PRtKH0NFvvvnmyUbQqHf2f5DTpi+T63DtnvSkJyWdKh6j
E/x964jYgo+28847pzjwec97Xrpn2V7gsfAH7iHfgtZJLMKPyfYigx3nN9Kz
qCuW22aPAu0De7/PPvuk9RsHPlW1cj6Tb8AmZN2Lx4wTuUrz3FrUa2/BOidn
fKsvaXM/g6mGOciHUM+N62Mj+BHW9tNOOy3xwHqKffKTn0y9B3N9J99L/gJP
OF585l65b3IL5j1fw+fII7Ez9DS5TpQ+lw6Sro3dxnN+6UtfSj0daHB81/rr
r59ez6b4ve5zNHEEusOctTZk/1HsOl5+caJw7Y0J89mYEuPyWXIOS75dDGqe
67fdy54nxpLPyO+zlpkDow7XlJ/PRljTre38CbbAtX35y1+e1nm2w3PW7te+
9rXJt59ovZ5xo15CHQ+9xeGHH55qR/GaeiP73qyL9z24DH0O7XnF//AYW8LP
YdfYL/6O3Lv8tXyUe+zcvvWtb6XH88GeyMPqW4unrj83mQM3z38ZVf5qdnCf
1dFaA/QPcV8ejT4l+wquuTVLDGGd4U/SK1g7xKrAd6XBMI58/4EHHjhbjlL+
DUeWtdZqCJrKv7QFeQ2038kFF1yQekCI68VunTUs8gXWA/VvOKd+1OGwL+IW
85WPQscg/qOzkZvI9oI9z4d7x5astdZayX7JU8t1up/+r5e986Tp8Hg+vJ5W
4wUveEGyR/Xn8uF789Htsfpzvg+/2y2+CvwL6h/oa/P+I5PpEWGMGp/0fNZz
vog1K2sdfbYeNbhxPc5ALMp+yGF4Db+UT8Hn6PT7/C4eEjsbG7lWUZ/NUeYe
cAx0TmytNVCcJTdh7RV36QEj16PmCX+AR+Az9tNP7IT75xzyWHDPnQN9LBvl
3tXtVq+H91pHutXviZX4JXJyfMp86HXhqD+WD7GQ8ckG4WMD3SG3SScl14mb
xlv3On74GnwQvgI/RDzr2vNj+ZDuDZ9BLGxt41fU/RP+pLGLA+EXWx9w63xX
897apJex14lPrB1i12zLmq5LbhLsKy2TOIE/UK9pZU/ZCjbb4z/96U/TfRp0
3ZN7rQeFc8BFmsN8GOs2rf9EDnZGjT9OQ76r/pwxS6ehz6aemw62Ccdlb778
WP3wnM+zB8RNN9000OtSGujgxYjmHb9OjDdWvtHYM2/5GWeffXYam3yFnAOT
t8Jb4afcA+ubud6NC/I5+Ctcle+2DoiZ2Qzjia/qc8wBNVm5vlNvJFqeUeYl
XVfXha+OD2yivmoiEHu4h/KqtHHG10SPzCmyO/XH/d6ZK4HxOMjgKHuHa4xr
4uPLCaiFwDnX4TqKV41DNvktb3lL8vX5CtZ+foNxal7zb3vd/9M6iJ+i4fMZ
bEQ3/9Ljnve6bBv41KNYCyx3KH7ga9PKq2Vtu/4Qt2W8vPjFL26kFmxUMVk7
2PkeY44Ogn2gmcn1EGwC/9D9FUPgna0DYkDcgVya2FaOgu2gv5loXag5To/n
M+RcfYc+aTgLvgU9uPy6c/I6r6e541/rxUwDMCrI+0Ood2SXXatetelNgubS
OYd9mDhwALh53B0umD+efSfrgscc4qTOn2JLOQGH9/d68E9x2DgB842vr3+A
Ndrc19cNlyXes5eG+cpXwBXggcxZMZ98lHPvR47IZ/h7xTviwgsvvDDt3eF8
2a+6r4Avx1ewIc57VPYAYhfxv/IT8gNi7qZq7CaCsA+TAy5QbCYvZU7KJYvp
cTAO/rrHttlmm1Qv0/nT+mGNdXh/r4cYnraa1tX3iPXF/XxWcT6/lb4Sz8u3
5zPgGXwvnZw522TeOOddrKH0XWwZ7nyY4XqrXWCr2WljpjMObCvcHzn0sA8T
g3ojMXXO6RvvY8Xg9cPrcIJyNHVNSv4MdTUO4wjnn3l/j3mfXJE1qDNXVM9V
e697ahwef/zxKU9B39yGvRDxFuINuXLnqUbZ+Q1zfxHX3pogN0TjwL8q5e/l
48lJ80/lDwK9wTjHt8nTyFeLv/kPNKzjHfwK+gE5Gut/fvyd73xnek4+EIcl
tyh2d8gReYzmTU5z5syZyTbJXeT30zPlul/3UgwhjmljrkBvGPEPG8H2iYPE
Jm2wX/0GHkgsIabg29GTldRPhc+pP6D8FJ4p0DuMZ3aC3gX3QEco3h7v8Lpc
Wyv27nzOfMYpiOdxhvIJ/G+P5bhA3Gruq33I76VplTdjH/xsey9hNkJsJLdu
3uBKnXMp62qvwDfx4/iG8kTiq5Jyc9l/cJxyyilNn05gksB/mWPiDH5FCbX5
9FN4GNqLvG8jveUwAQfM3/N3qj9o0x4FvYCmBm8S/kPZ4G+IdfAYNIpTqcXt
F/hEan30JcCnlLJn+URqDPmDcru0pW3XOnTDmWeemepwgn8oG2IM/QRKsg8g
JqOFkJuR/2vjPmF18Afw+OJy523+yGP5P64fJ6WmFZ8yDP1vsj5KHmyUewKW
DuNW7zHxRUn2AcwjeVfa78yntrUHgDyl/LH58vznPz/VL4nNzSGP0wrI29oT
kQ0pIc4bD1n/QHsXNfnlosT4Yizwx/VFsK9Gt0NuRu0emzjo/Iw5ryYu1zvn
HHT98Dg7LWchV1Xyvcj2IfyH8iH/aXyqsei1r1PbICdkHBqP9CT1Qw4ga0To
CPCxfP1B7sfF3+Y3sA+5J4OcZT7kZHCRamC9ho3w95SqE832AYfMNgfKRd0+
tGEfvskAZ6meJGu92AI9Seix9RZRi+b3rB/TewlvNigbQT+ee1nQsKpjr4M/
QzuvH07WtNJ3lHo/+GnsoOtNgxMoF8PgP6jVUNdovTK35DT49DSHajf0UfW7
XkL0iP5eNkPt6SBQtw90cd1yErgR9S16Knkd7Rq+skTIyfKXwj6Uj2wf1GBN
pp9UG0AfRW+Y/XP60c46Jmu0vjV6JHqNmINf38+a8bE40E77kHtk1A9/g/4Y
+ml4ndxMqfuWh/8wPMj2Qfxbao8m/AMNOV2luSVn223e05XSnatNxQfusMMO
qddSHbPLf+T+3PTOuE46WDyB2lh5VnpOtRP1+jEaoaxjt8+E/eW8rn6o41Zv
QfOlzkZ9fal7lmf+IexD2TCu1XPQGamPbLuOYCx0sw/dcp5sxtFHH/3v19Vj
KvlS9XO53zFfX88J+uD6oV8OTlHti/mMM1BHI0+sJtZ1pEWlMc48Q90+0BSq
p/W6+iGuYBu8Rj/Vyy+/vChNdR1hH4YD1rhsH+TeS/Vn+eZym2oyzC9/i17X
et2YZ8YrLkIMYg7La6hr9bdbo8UiNJk4wdwH2fjWH03/i/ohhsm947sdeW8I
NiP3OqzHF7Pr2ep5PRvbXgszHsI+DAfq/kPJ+gd+gX7NxmPev9aabC8ePXNp
seUy5DD0zFL/iW/J/fLxAUcddVSa/9Zw2iXaHlyA95rbeAs9NNgXdbBsCY5g
1113rWbMmPHvQw2t3tvqRHKMUbcP8hP2huB72PtH/ZXPEnfoycv2sC8+p1S+
OOzDcKDuP5RsH9Soihv0S84aJOt4XQfh99xz3RzEPeAJcv9n+yLop+1z9JrQ
V1WfTvkPfDz/Qh8ueUj6Ru/F1+Ah5CPy4Zp29tKp2wexhXoR11qPPofPEtt4
HZthXrFlYqYS9dZhH4YHmZ+0LtpboVTQ8Vr/zUHrvtyEvhj5wEvy23OMjweg
mTA3M3Ieod9xf90+qNvu5EQz2BW1GeIaNo7/c+211/b1XAaBsA/DAbzewQcf
nNZVvjOfuER08pM4w87+czgG6z99kt4lXidHj4OcatT5SXY47xvUDeq07DPl
tXJKJdrssA/DgXp8oT9MCb2Ru8G6q7dWji/Gym/yDcxN+QUxhziDnzHVPnxn
frO+v01Gzp2q6eRr5J4c9qcqDWEfhgPy+HJ17IOejvJ6JaJX/QOwEfbqy3tW
4gmnumd+Pb6wD6le4vyC+uExMRL+gd1y6H1TYv8H+g7jKexD2bBuWj9pCeUE
cW8lgi1Q8ygvYV6xebkvZae+SY86eQZabDok43eq5yC+M+8JpmcKG+B61w/x
nbpvc8q52b+wl33O2wbXXf8o+SJ9kfUMDZQJ+j/xuPFozpSq15N/MM/lKMx5
+8vjHXF71uW8Z4ie11637LLLJv5Pz4VBzMEjjjgi2eBuWof6786JvsIet86V
3tPf4T6VopViH+R+2Do86yD4ncDUwH4K9tuQv5DH10+qRNTrN9k6OgKagqx/
UK/lEBPjAcRTYhG9LzprKacC5oj1VE9Ge0jbv4Sugp1Sc+539Vhqz/Eocp5s
nn2x1Ws4T7xJKTaCVlz9W+x/UTayfTCvStY/sA/2de51/3gaJRonfaEHATpK
+k08xKxZsxLPg8Pzu1omv7MJajjqvWhzH0f5Fn6PWo8SEPtvDgeGxT7gH4zJ
8fYQE9/rBaHmggZKrUnb984QG9FsiJvoN821EvbXozPDPYR9KBt1+7DVVlul
OLdE8LvpGDtzAvWD9oEWMu/5WwLkn+VG7QmEvxCD+Dvavt+HPAyNelvsQ5O9
R0sGvQP9f2ctYwmw9uMO2IVhvvdsttoSfJ81Wd1om+vo3Bd1rosttliqYbFX
o7ipqUNsZ5zT/hkvwzxW+g21jXoq5X4k3XQ7bYR7LBerR4LcQIkaol7BV2Aj
5Gxxq+YdvXjb9gRyT+TLjSm8sDwtjYmYTq1LU4c9ptXq0f/RApbaw6AJ8Lvp
+UrzH6wL6inwjHKU9gkcdrDd8hvqT+2jrH9mG2q32AX6EfljvWjxPLmHZr2e
Xe5W3sjP8Y6xXuNxeTY/O49u/cDza+vvF+/gqQK9oUR+Ukxubxm5dXqoXIc5
7DAP8SfsIS5CflRNaRMcK58GT0pfomcfP07+WO2beZh7hrMLfpdvplPVE2OP
PfZImhu2zk+9ANXL2C+a7lWe2p7TnpPb9Zzcu8fzHtT0LfwpP2lMPd7t8Bqf
4bN8pt4+pfZQbAIl2odLL700+axZi4i/aztf1y/Qr9GGizHkNHARg9rXO9e2
5r3A2ARxhP191L2IJ3AktKA0ubvsskviH9gH/S74ePwdGhv+H027n3K2eAE1
rfZFo/vgj3jO35afy/3ArA8+x7n4/3h7AHiNz/BZPrON+9K3GaXZB2PTekAD
RRNgbdE3YZQgzrBu0lvRfHRq2vq9b5j36p+jlza9hmsuvplvvvmSf4BjYCPY
A7rJvEcgXpCv4Hn7eejvVep+Hk1gvHvW616u3cZA53gYb3yUZB+MUWMsxxXq
nPDSo+I7ZLiXbIR9O3G09fvOVtBa8fnNVf40/0p/f71sOmvex/sOcYt1V09t
vr1ac3bBfFf7Kn+p1w1fwbmwB519cWjX6UW9Xl17yT3zBgU21Lw0tv3kX+Gi
+Y58IHuieG4ih3o5WkDxoN+NG5y+tZXGxmN+51/Ve7XS7MlbsA/sRFvtAxtg
D1uxN96JTtq4DX/xX3PZvVUXbl8uWm2+BV9fLQcff9VVV032H6dpHo9lUz2u
5oOum23B7dhLCCcqTvDT7+IaNWdyhsbvWOuP8axvn/Pg78kfTHWtbMlgB/Q1
pkUSk6kRwMvgavjNuBo1/56byKGWVv5GDsLvdDQ+x9xXf+AxHA1tv9y0vWLk
yLyG74ffZef5j8YPG9YmTYlxa43S4xnnYC/NNnD3TcN6zfbj9eiZxV25R651
Xo0JX8tjfqr/sN+5eV3nNX2OtYHNNYflIPTANC7wCjTe/Ae9hPTc41f06rep
G8FT8CHUmgxqT6ISYV03Z9niXmsF+nUYO/o78wv1YbMHXc4/GQf6OVtn+BHi
2rPPPjv1bzVu+KVTaS/yZ+PE2VBrkjFb/07rDhuhJqEUncZUw3WwrqhZdR+t
7+qirAU0VXpi4PutD+a4cec+Wxfqvj5NprXJe3GNmd8xn+UO6CHpBibDH7iP
+nfKLbJZ1sNh1qs8Gug9YHzLtfAFHXgdeydYA/JjU3H4HtwyP8Ph3uOYjCvj
xrhwZM6Jptfr+JgzZ85MvoW1SvyDZ+6XveCDinNcF/ko49FYtV8eX0svV3F1
W3yZtkA8qreCPpruofXeOOID8AFz7MXWsgV8R3taWQtyDXz29dWX8iP5GLhG
vOIJJ5yQ8qfjxSO9gr8hD+l7+X80lfikwP/CfXNt8uEeWaPNufrj/T7YJtwy
n4B/Kb7gR7AH8tP0Rnqs4P2MI75G1p+wG7ipvPcLH/Scc85Jn2dN4atOZv7i
zHyneEgvSHYJv5D3pzCW6DuNZRxL8A3/gX7bOL98f/S9dT/G0kOwseyJa5rv
uXtofXcf6AWsW3w087mfugpjg65SzxvnSysxCpq2UsEm6SkgPhVvmKPyzPx7
nKaaY/vL07Ooz+BLGINZj8aP1btATMrvsdaLK+mU2IscG4wFz9Fu8o35scYr
m8BeqVNkn/RbYiusjewGO2Hs1uufRxWur7yEmMH9wD+pF+/MH3QCH06n5Lri
FcQh2T+gE5jKWhZ8kbpZ95Xt14/IPgGBdiHXQvMHzHdrN/++G/gd1imxhXhW
zwRrQI4lM7fBXpjXeCjxLn0jrR9uqltOzbjgr+Q+0vS4/Bbv4x+zT/hz9meh
hRb6tw5PHM3/GfVYgx1gk8UDuAKcYy86Kfde3iHHJO6ZGGJQMB70xnIvcaVy
LqOWn247+Ac4SOsH30Fc2ksuwLqNe8Bl6S+Iy1b7guvmS2R7QVcrp0bjaH77
/DqfiG+wzx0dgzFqPaG5wX/Vx4qeL+yWeYA3s+axIzgKObhRBk6Bb8fnUtPp
GvXqV7mm1gTX3h488lmDsrfiQzGN9cX4w20FV9kuyEvgoqw78qyT1R9meyFX
zr8wb+VraRPEuHxIvq+YwR48+BWw/vMDPJfrlZ3DWOsIHo4uSoxjTMu/68U0
ylyEOSVOYI/xkvi+2cUWGe6DmNC1tD64toOs4aCVxl9lrtJaYS0INA/8AI6b
X2oe8y17HVfjIdfw8RPEwXIR6q7pOvCZYmXjkg2QK+PfGtvyI/yR2a1fdNV8
DDbNuYthRln/ID7DHbCxYjQ+Wq89b9jV3KvTe3GWg67xUutpD2Tnj1eSoxr1
mLFp5HyYNUOdHRs+lX66cYgHpenM38NG+F5zHN8pb9pLvzR2Jefg2BXx0Shz
W3gh/A0f3b3kn/Vq5/keeCT2QZ0XHnrQ9sE4yHVmxoF8at7rPDB4mF/6peME
cEP2b6NXHvS4wDHIyRmbchTihF7Xjbwnk/dac+jGRxV1fnKie4DJK9LKTuYe
9BPyV+LbXPeJN404oxlYx2mkjCU9iOQzm9jrQm7CmMxzHHfRK/ik8njei9/C
eYwq2AfaMflNvK2cEn3B7CAG4S/kvf7UVzW15ypbICdOM+9vwJmWur9jyTAm
zCV6GL65+0BH0wTkLenzJuMDGMfGcxN5uTZCnxP5ZPcU14dz5KOP5Qt4XH5R
vzBxP+2LGKXJPU/EGbhV+S55bLr+tvXNG3YYR2r31OzIJbgfTflxchf6tWcf
gC6/F9/Wa9Qoy3N6r88Y9bUGv4MHzvt64nzpH3Pf/qx/9385A3vWyCfKd4gx
2Wc+WdOQA8Njy4urz9X/JzAYiEntRSDPrdZCTqzJ2ibcmPxJrhXGT/aSp5RL
VScsH2ouqCOJPmH/ihvponO8kHVmrpV4Xgzi/3I//Hg1efwN8b5x0Ya9f9kv
/aj4t+4vLkUtQGDqIXdIa8A207zr19GkXg3vbjznfgJqWWn/ZweaHjYh12YY
74PYF6/tyL1iaE/Ur7imcsDsBG6CvsD/cYC5TywfUm+4Nu11woeQrzVO6Srl
qkrZo6RU0NipwWKT9efQM6Hp2gXjmY3Sw8RcN1bx8OPtSyAe9Xfwi41x44cG
r+17Xw0KrptcL1+B74DfoUk113J9Ha2aOMRaoea7bf18+ZC5vwf7L68RNfxT
C/UPehzLWeCxrMFt0KDU+8ThyWiz1WdefPHFya80VvDz6rz4FnTctJPWPraO
Nkp9YeC/QUeCf8QBq2ORo2JXHccdd1yquVHn3YaYohtoZMRCeV8dY6SEvQRL
hDFgLwJ+PL+TZrEfOsl+gT+Jb6ftMe/FxdYONcriDz4Frm369OlpvOT+NuIR
vGQb7Fyg/5DPUs/Dt1Q3PKj9k0cJ+AUc8FprrZXmFK1h23w1sYF5jovSpyb3
QBM/sBVyb7m2m4/BRvA5abzaZOcC/YVcKx+Cxle+U81wW/2dUqHGXw8v+Ypc
Q9vGWN054d/5w3wF2id8BJvGJoiL+D54STEzzUbT/Elg6kGPry4Yf6JGQw42
/MX+wJyTE1enYA3mw7e1J3UGfwcHqT+UnJzYAh+vpgAPqWfnKNdijRqMYX22
8xim4YpcVX+An9LDmm9uPZ41a1ZRtjfv0WSM+FnSuQf6B2uaegD8mbyLNa+N
PnBJyP279I2UzxLbj3oflUCZyHlwa5x8J024tS8wOeDs8v4xrqcai+jDFigZ
ajP0EKHdoedQFzDKPYEeDehj9PvESdLa4vPiWgZKR+7RzT4Y05G7mjj4CPZb
VO+kBsv1dF0DgdIhX6Vfhb1E25ajLwU0h3wH+SC9FejkQncWGBbwGaIWY3Jg
X+kb9KrHO+j1qu4iEAgE9OjS/1V9XvRMCQQCGfwuvcHVNapb0ve1yV5AgUCg
PdDbQb81WmQ1LfoPRj4zEAjoLas+kw5K7ZJe4d32sQsEAqMHHCRduj3tNtlk
k9RzMBAIBEC+R320eiZ1TZHPDAQCdeAacJSx/3EgEAgEAoFAIBAIBAKBQCAQ
CAQCgUAgEAgEAoFAIBAIBAKBQCAQCAQCgUAgEAgEAoFAIBAIBAKBQCAQCAQC
gUAgEAgEAoFAIBAIBAKBQCAQCAQCgUAgEAgEAoFAIBAIBAKBQCAQCAQCgUAg
EAgEAoFAoB/4PxA7QG8=
"], {{0, 166.}, {264., 0}}, {0, 255},
ColorFunction->RGBColor,
ImageResolution->72],
BoxForm`ImageTag["Byte", ColorSpace -> "RGB", Interleaving -> True],
Selectable->False],
DefaultBaseStyle->"ImageGraphics",
ImageSize->Computerized,
ImageSizeRaw->{264., 166.},
PlotRange->{{0, 264.}, {0, 166.}}]), !(*
GraphicsBox[
TagBox[RasterBox[CompressedData["
1:eJztnQmYjWXYx7v6vuorJTshoexLKAllDW2EslQSSVJISiqSJUKJECJlS6Xs
S7SQLcouCtkiChUVJS3P53ef65nrOM6MMTO8c8z/d10nMufMeZ/33P/nXt/z
5nvgsfoPnXvOOec88X/H/lO/eaeqHTo0f+bODMf+p0G7J1q3atfywVvaPdmy
VcsO1z/wP8f+ccSxx3fHHv977OGEEEIIIYQQQgghhBBCCCGEEEIIIYQQQggh
hBBCCCGEEEIIIYQQQgghhBBCCCGEEEIIIYQQQgghhBBCCCGEEEIIIYQQQggh
hBBCCCGEEEIIIYQQQgghhBBCCCGEEEIIIYQQQgghhBBCCCGEEEIIIYQQQggh
hBBCCCGEEEIIIYSIEf7777+4R1o+BhEsQdvAmX5/3ufo0aPu999/dz/99JM9
Dhw44I4cOeL+/fffeF/3zz//uD///NP99ddfCT6Pn/Ecfh+vSegYfvvtt7hj
OHjwoL1OWkwb8Dn//fff7tChQ+7nn3+Os0NsLD674fn8HNtJCF6P/SVkqwnZ
YEL2nRx4T47rhx9+cF988YV76623XNeuXd0zzzzj+vfv7z766CO3ZcsWO6ZI
HbD27777zs2ZM8ctW7bMnhMNjp21LF261M2bN89eE3kMhw8fdrt27XKff/65
GzFihOvcubN79tln3cCBA91nn33mvv/+eztOcXYSbofLly9348ePdz169DAb
eOmll9ysWbPct99+a9oMt0P0snnzZjdjxgy3evVqs8looL/du3e7+fPnuyVL
lrj9+/ef8P7omOdgp6NGjXLPPfecvf+AAQPcJ5984rZu3RpVB8ldN79z0aJF
7uGHH3a5cuVyl156qcuePbu77LLLXObMme1RuXJl0+aePXuO2ws4H2PHjnV5
8+Z19erVc19//XXU92EP4T3uuOMOV7p0aTdu3Li4n/H72O84h40aNXI5c+Z0
GTNmtPfPkSOHy5Qpkx3XfffdZ1r8448/Umz9InXg7XDx4sWuTZs2Ln/+/Pa5
8/ljB1myZHHZsmVzt912m/vggw/MXjz8vW/fvi59+vRmw/H5Afb4SZMmueuu
u87VrFnTLViw4Lj3x9fhH1q0aGE26HXAMaABjuGmm24ye//xxx9TxCfyvr/+
+qvtLxwTdn/NNde4hx56yA0bNsyNHj3adevWzVWvXt3OQ758+VyXLl3s/T3J
1SDH8Msvv7i3337b3pt1onf2Hn4ve9ETTzzhrr76apc1a1ZXrVo188vxxSQi
9sAGyH+IpdAY9o5O2rVr59544w2zg+eff95VrFjRNIH9YBc+JkquBnl/Yt0p
U6aYrfv3b926tRs+fLj5HvxhlSpVTI8FChQw/7x3795kr501sO/UrVvXfjfa
W7t27XHPwdaJG/v06WN7U9GiRd2rr75qPhuSq0HOy9y5c23tl19+uXvqqafc
zp07j3st70Xs0LhxY9Pogw8+aP5YnB1gGytWrHBNmzY1jd1///0WU4bHe8SX
2Fb79u3NVrEjXgPJ1SD2RXx6++23W7z16KOPuvXr1x/3WnRAHIr28EUlS5Z0
Q4cOjdNBUmB9+/btcy+//LL5OOx748aNUZ+LzyVG7tevn8uTJ4+75ZZbLG+E
5GiQdW3bts10x95DDEA+GA32yffee8+VLVvW1ahRw02dOjXJaxepB+yQOgH7
OnZYu3ZtqytEA3snJ+M5xEyvvfZaXB6TVA3yevbzXr162fuzD5BzRsP7oxde
eMF0EL4PJAXyWPJetHfVVVdZzplQnomGyFPvuusud+WVV7pXXnnF/j1Sgxs2
bDiunusf+NyFCxe6OnXqxGmQc/rxxx9bfFmiRAmLL+KD9aNPtPfuu++ads92
0kJfBjtctWqV+T7ioO7du8dbd/N6IxfBVtjvo2mQ/CqaDWKr5JLs416DvBcx
FnZdpEgR820JnXNvx8SOhQsXtn0gqWD/M2fOdOXLl7c4Fy0kBGtFA8TF5I3k
zZy/cA3iH1kX+0rkY8eOHaafm2++OU6D7EvvvPOOreXWW291X375ZZLXczbB
uebzwT9Qu+M8na1a9PtwrVq1zD8R65wqXoMXX3yx+TFqpNFskFhy5MiRZn9e
g9hvuG+k5pcQ+ILt27e7Tp06WX3iySefjLcOezLCtVO/fn33zTffnPQ17C+v
v/66xeP33HOP5W3+9xBHX3HFFe7OO+90DzzwwAmPZs2aWbxNLO01SMwwZMgQ
d8kll7h7773Xeg9pGXRGvEFtnpiL3IP+0PTp060Oxh58tmkR+2EfLl68uO3P
1CdOFa/B8847z3wZOoxmg/ha6g7UPL0GsUF0ie0SE6Lfk0EN0cfO2HVS7Za1
v/nmm3Y8DRs2tD0isa9Bb7yGnqHXILq86KKL7Peha/9gbf5PnkO8EE2DnJ/I
fk1awfeksSV6o+iO/OD888+3c8q5e+SRRyyfxjfy3LNFi16D5CLs0b7OcCp4
DZ577rlmS+RqnLPIB/+O78IGvQbxK/QAsNsmTZpYvHYyeA0x66m8Jhqsnd5D
7ty5LRZOjP7RDL1z9E8fD5/sNcj6brjhBtMoe7h/EGfw54cffmi9durLXoPU
WVg/fSB6f4mpdQY9u5TSENvwmX711Ve2t5Kr+L2sQoUK1o/iM8JusNOePXta
7Zpe1tnQn8F+Jk6caDZBLkNudjIibcBrkPOGjokbsLvIB7kXPQ5q++EapP9A
LkoslhhfRB9j8ODBcTWcyHmTxEKfm/yUz5UYIL5alMfXj7ABapj0B9iTk1MX
Dc8HOXfk5gnhfQUxMOculuF8sn5iiTFjxpj9ZciQwc4texlzIdTnyMGJ/8nZ
6cuQi1eqVMn2LvbNyJmRWIN8kBoLmqA2MXny5ASfz77D/oMNoAX+Pzl1UfwA
8zjFihVLVJ2Tz433pi7CzAB1EWLTpIAmfG+Q/jf+K6F9Nbx+xb5MfRaSo0Hy
G84/MXq5cuVsT4hv9sDXRQcNGuQaNGhgz41FP+BrxPR6mAvC/xMfMZNRqlQp
9/jjj1u9OlpvjPnBMmXKmA7RI+eS88DvitVc0dsVeVWhQoWs3o6tRIP1oTfs
jdiN2ih6TI4G2QOYjcEHXHvttTYrkpBdcWzEy9RD6JfT20sq2Do+lM+VPA1t
EVtGe39f/2VegN4kcyzElpDc/uCmTZus70rs1bZtW+tZRtqSryujV/wFnxWx
QDS9plY79DkfsQPngXoa5yxdunQ2d0HNAJtIqMaGztinmR8pWLCg6ZYYqmXL
ltZjJp/GplPrOYBony31Jvw+dQZyHPrj0T5b1o9e6SNjs9Qm8WPJ0aDvvT/9
9NNmg5xLdBGfDpiNIS4hfqRPTZ6VHFgTv4Ocg3olvXKOh2PlGPyMOXU69lv6
eJwnagZ+nSkxJ0P8wb/xIDZnnf5aDY6B96JvwewQPoM6bmQfw8d2xKipzSf4
nI88DlvD31144YV2LolD3n///ah2wxpYV/ha/Hwhc1133323aZA6BPE88RE2
mhpzRd9v4dgi5335vOgJ0DtmP2IekjoHz/N2yN+ZIWF2kjjsxhtvtNkySO6c
DL979uzZFu/z/lwrQP85UgfEGxMmTLBcgBoPx8IekBz8jAI+nXjY56Uc55o1
a2w/wk9TI+e42XuIGfiZx2sQDaONU9Wgnz3gPchxsaWOHTva3kC/n5klekbY
G/H39ddfb7WkcH/hr8lg5o08iRibzyXo+iHHxfkhbyPnoweG32MfIZagRhWt
DhV+/QB7Iv4tci38bn7O72U/5tygRXIq+sa8J/YR9F7EcWLj5FDETtQTsYNw
fIxJjwD/jn03b97caivsW+vWrbOZZmbIqP1hI8xO+poAr2WG61Q0yGfhNej9
G7ZDbwN/QlyIxrF16mXUdIgZiVfxl8x18u8pAevnM0YT1AL8jDh7DfGuv24B
jRIzcj4i1+X7O8TI8c27oUHq7vRgqI0y6+Lx+Q5z2pwD3h87RdfsC35+Hj/M
5xSZAxN/ca6I54jPyJlefPFFO9aUvs4kMfhrYLA7Pkf6OORwPucjhqIfG1/u
y/kgRscfsN8zO+JroZGv4bnUdVgvexvniveizsbnQg7NsQRxDvjM2WPw2WgD
/bDP4q8jj4e9mPNFvo+ds6eQ8/IaNIE98P/UjZkrC59pxB6Y80Ib2GhCGpw2
bZr5O+KP8L2A80pMjD9iH2NuFTvE/rBDrwtyMXwE/iGlYd/F75ETU/NgrXym
xKm8J/tQtFqk1xbPodcXX38BW2FvJo/Dh/OacPzsOn6XmBgbolaEnpilZ58j
zoqWL3l/Tn0Lm+WzwhbxD+wtfF7sxafbDv21n+S0rIP8ls+Q+Q2f8/G5n+wa
SK9BzgO2iHbZt8hD8IuRtVD+zvrIFanp8F7UWIl1qZ0TH2BfZ+I66PBeJ7ON
xHUcD7E3tuyvP4vvtayNdfTu3TturpEHdTtyIHwXWgqH1xBL0kMlJotvjtrP
hlPb57rYSH/hz6PPGZg3YT/wczW8P+cyPo2nJOwJ2BIP9qcg9lDeN/wYEgPP
ZX/Cf+C3sUPfR2UvPp12yDGyh1DTpGZMXEC/ij2cOgM5L34ssfg9C1vEDthT
2FuwS3wrcWjkWvw1cNSuyBmIY4jPiO/QM/0nfMbp+kx93kv8Qa+TWvcFF1xg
vo9aGj6GvTKxBG2HQb9/rOJrFsTv3g7xI9ghvho7RCsp9Z0EPufDb3GtG3ke
fo9YhhiC/Cep11n5fZlaOD7V+zfW9Nhjj1neG21uxsdV1NmJIdAA54DYhjiH
uJ+9PCXPAb6Jfib5KT6DvJfYDf9NvYRYRDactvB5NnUsej/eDtmbyTn8nF1S
7cLX+chhyPPpV5GzkIuR8zOPkVI5Q/j3DJBzE2Pi34jVyQOpDbDvRMsViV3p
YZHjeF9KnE/MxrEnZx7c146Yl6R+QpxJ7Mw+Qd7UoUMHi+uSOtMszg78nDv7
PzVV/50E6JKeAPZzKjULX2vAz+Br8U/kOfg+6kmtWrWya1tOx3f/+LoFvpX6
OJrH3qkxMGNBPT+apjhe6stowsfo5KnECcxvRYtrT3YOfN5Lfkt84c8BNUt6
bJ9++qm+c0QcBzbDnsz3YjAviE+k9ku/F3uhNpxQzO9rDeRTxIb4OWYFfK2B
OhY5X3Kuq04s4XMz+EJ8L3rEF1M7I/aNlivi96kVkR/7XJFjp5ZIjQxfm5hz
QCxPbYP6pO91omn6w9S7+bkQ0fC1V2po9EGpl2CH+AZqtdSFo9X/sUt6bdg9
vTdyHOyOejW1BnzQqdQaUmotaIqckNkFrqtmX2FNzDCiqWj7iu+lEj9Tn6dm
RV8RLdFzI36Oliv6c0Atkf4QdUpeR97L36nBJPX6AZH28PPnzN5RP0BLxGf0
NbAvX//335uKbTHbT60auyOvIr+i/sk8RdBzAMSEPif134tHPoafog8Zn6aI
a9lT6Av7uBY9UVdhXX5OxZ8DYnf6uz7vpcaDL+Y9VG8RScHX/9ES30+CttjX
0Rr1f2yLeR36Tvw7+sNnkgOuXLkyVdUa0Ao6QVNVq1Y1nbAe9hjqUswiRct7
iVnx//TNWRvaoq7CXBLxQrRzQCxPzx0fnJrOgYhNwmM6YjhqCvgR6qjs88R4
9PnIm6hJ0qON7BGnJsI1RW/Za4pjp29I/SVyrjv8HFBTYq3+HNCb5Bz4vJcY
nl5raj4HIjbxeRLfeUN9hfiU67Kpo5LzEbcS88UC/vs6mUeh5kSOiKbQEjUp
5t1Za7RckRySuJbZX3ypPwf0M8h7Y+UciNgFu6R3yMwX/g9bjO9amtSO79Uz
N8qsvO+REnczi0V9JVqu6GN05gA4B8Tm9CBj8RyI2MN/7zd9bfpdzMeHX5/i
6/PkVrGSC/lePT1SX3/Bt3HtALM05IqRvTx/Dsj/OAex/r0FInY4mQbJt/CT
5FbMp8UK/loO5t65XpW6KbkidVSu06HXHr6nSIMiKBLSoL/mm/kwbJdrrWKN
8HlaruPg+9vor3Ntfvh9VKRBERQJaZB8iNk2ao7kVeRLsYrPFZlrYR3UnMJn
fKRBERRpRYMnQxoUQSENhpAGRVBIgyGkQREU0mAIaVAEhTQYQhoUQSENhpAG
RVBIgyGkQREU0mAIaVAEhTQYQhoUQSENhpAGRVBIgyGkQREU0mAIaVAEhTQY
QhoUQSENhpAGRVBIgyGkQREU0mAIaVAEhTQYQhoUQSENhpAGRVBIgyGkQREU
0mAIaVAEhTQYQhoUQSENhpAGRVBIgyGkQREU0mAIaVAEhTQYQhoUQZHWNMia
uNdU5D2VpEERFKeiwfbt2wd8tEmHtXCvpd27d9u9dlmX7vkiUgMn0yA2261b
N5clSxa7n2aswfqOHDli9+PlHtcdO3a0+3tyP/ADBw7EPU8aFEFxsvsucf/a
UaNGmd0OGTIk4KNNPP6+idxbifvwcu8o7nPNGgsVKuS6du1qa/NIgyIoIjXY
smVLu1dt+M/xI/iM8PsUpWbI91jDhg0b3IgRI1zNmjVdhgwZ7L68NWrUcIMH
D7ZYNBxpUARFpAa5PyZxWyzeB9rnfNxnd8qUKa5JkyYue/bsLlOmTK5cuXKu
S5cudo/r8HvS+9ft2bPH9ejRQxoUgYCP477R3Iude0dzP/edO3eaPUfaa2qE
Y+R+wXv37nXz5893nTp1ckWKFLE9hT9btWrlFixY4I4ePXrc69Aevn3Xrl2m
2bp161rtqXXr1tKgOKOQ/02YMMEVLVrUYjbuVct9aqlhcN9MbDc1atHnfPjx
FStWmC8vX768S58+vbviiitcvXr13Pjx4+3nka9jTfv27TNtcn/h4sWLm2ZL
lCjh+vbt6w4fPhzQqkRaBJukdoEvqF+/vtkv/qB06dKud+/eZt/YMXlWatEi
x8LesXHjRrunbu3atV3mzJldjhw5XLVq1UyP27ZtO+54vWbx+6tXr3YDBw40
v0/8yf2x69SpY78rvFYjxJkEuyYGHTp0qKtatarVMLDr6tWru5EjR7pNmzaZ
3QeZK/r4keOcOnWq3WM+V65cLmPGjK5s2bIWh65atcrWEvm6Q4cOuc2bN7tx
48ZZ3MnasmXL5ipXruz69OnjtmzZEtCqhDge4rT169db/Z56Pr1B9NioUSM3
efJks390cCZ9Ynj8uGjRIosfCxYsGNdraNGihcXOkbXb8JxvxowZVvfNnTu3
abZMmTLW81y+fPkJmhUiaLB5cqLFixdbjaJw4cJmt/nz53dt27a12seZyBWj
xY+VKlWyvJWYmdiZnO/gwYMnvC5cs507d7Y1eM02a9bMzZkzx+pOQqRm8CPk
R+SKDRs2dHnz5rVcsVSpUq5Xr14W96GP05ErRsaP6I3YkUeVKlVc//79zSdH
y/nQ5Jo1a0yzFStWdOnSpbOcjxh09OjRyvlEzOFzxeHDh1vNI2fOnOaLyBuZ
o6E2gl5SIlf08SN99FmzZllvIU+ePHF1og4dOtjsS/i8p39duGapi/Iar1nq
ndu3b081dSUhkgJ9OOZPunfvbvlU1qxZzcbxkdOmTXM7duywuZqk2Hl4/EgM
TD5KzwAfVqBAAde0aVM3c+bME/oG0TRL/upzPjS7cuXKE/qDQsQqaAV/s2TJ
EtemTRvLr7B38jP+f+HChaecK6Ij+uJr1651gwYNspyPmQHiR/oO+Fr6J5HH
EZ7zMQfj6zT8Sc43d+5cO1YhzkbQzf79+61W2rhxY8sViU/JFbkugVwxMX1F
Py+HjyPn43f4ngGz1vT5wmPcaHWaChUqWJ+PfYCcb8yYMaZNxZ0iLYAvIs8a
NmyYzUTTr6Of4fuK5IoJ9RV5PfUTen34U3I+3zOINl+GX6NXOXbs2Lg+H715
ctN+/fpZPhiL865CJAf8DTkZWuJ6Q2ak8WXUbnxfkVlqnhOpD/zk1q1bbWaV
eWn8YWT8GK3PR5yKZulhcl3gsmXLLBcVIi2DFrluiDlMcsNixYod11ecN2+e
XZeR2FzR53zMY/M7yfno8xF3Mo/dvHlzN3v27OOutxJChPwW+dikSZPMD5Ir
okVyxZ49e1qdkh5dfLlieM5HXjlgwACbx6bX4HM++nzoWQgRP2iMXJFr8GvV
qmWxKf0MckXyR3JFfFh4fOrnscn5qK1QFyWu5VpAepPkfLxOCJF46CuuW7fO
vh+KXJGaDbUb6qkTJ060XJG+H7NjzAJMnz7dcj7vP8n5qNMsXbpUs51CJBE/
g0ovjz461yuiL65X5HsTyeuYu2a2k9481wH62U5+FivfpSFEasfPoFIrbdCg
gcuXL5/1BKnblCxZ0v7ObJrP+cgrhRApDzEls21cr0hfES0Se9LnY7aTPp96
7EKcfujpMYNKP5/vPIs2jy2EEEIIIYQQQgghhBBCCCGEEEIIIYQQZ5r/B8g5
hOY=
"], {{0, 154.}, {225., 0}}, {0, 255},
ColorFunction->RGBColor,
ImageResolution->72],
BoxForm`ImageTag["Byte", ColorSpace -> "RGB", Interleaving -> True],
Selectable->False],
DefaultBaseStyle->"ImageGraphics",
ImageSizeRaw->{225., 154.},
PlotRange->{{0, 225.}, {0, 154.}}]), !(*
GraphicsBox[
TagBox[RasterBox[CompressedData["
1:eJztnNlTVEcUxq0kD3nMv5AHK0+aKisPqbJSpcYYNSkDgwhIUso6IpuyCIiI
IqKiiIiKiIAiKkgUBCSkBJXNpSRgAEXQAmRXFlcW15P+OlxqmEG8M1zmMkX/
qq7IDDCnv9vndN/Tp/trZ1+N+2ezZs3y/5L9o3EKWujn5xRi8xX7xtbH30Pr
4+a6zCfATevm973z5+xFe3bZsOsLdpFAIBAIBAKBwrx+/Zry8/PJb+NGcrCz
o+CgILrEvu/v61PbNIvi2bNnFBYaSr8sX05RUVGUde4c7Y2Opp8WL6aonTup
s6NDbRMthtTUVPrd0ZGKi4tpeGiI3r59y/tpSUkJaaytKfHoUa63YGJevnxJ
rs7OtG/vXnry5MmY9969e8f7ZdCmTdTQ0KCShZbDw4cPyXblSjp75gzvi/qc
OX2a3Fxc6ObNmypYZ1nU1daSxsqKcnJy6P379wbv5+XmktOaNVRWWqqCdZbF
8+fPaS3TKiU5mV69emXwfmpKCm0KCKDamhoVrLMsPnz4QNu3bSMvT0+6e/fu
mPcw3qzTaili+3Zqb29XyULLorW1lWu2ccMGqqqqosHBQWpqauJjjgsblypv
3x7X/wWGoG82NjbyMfvHRYto7pw59MP8+eTj7U3V1dV8PBfIB/0O/bOrq4s6
Ozv5/Bx+PTAwoLZpFknkjh1Uyubn6Kfw62Q2Hj148EBtsyyS8LAwunr1Kv//
rVu36FhiIjWKObpJCC2VQ2ipHEJL5RBaKofQUjmElsohtFQOoaVyCC2Vg2t5
5QoNDw/T9evXhZaTYHNICFmtWEE/L1lCfzg68rymWOcxDqyfpaWl0Ypff6WE
I0eopbmZ59l/Y7rGxcZSd3e32iZOe5CXRHzUurnRrqgoarh/n6+fIU/05s0b
6ujooINxceTm6kp5Fy9yzQWG3Ge6IW8e4O9PN27c4Gs9+rlzaApta2tr+c/6
+/nRP5WVXGcBUW9PD8WzvubO+mJ2djb19vZ+Mm8OjZETLi4q4r+HPtzM4gC0
nolgbMa6rbOTEx0+dIhaHz3i9RnG6AHN+/r6KO3kSXJeu5Z/7ZuB9UaY4yQf
P041NTVcV1P7lBRLsba2e9cuKiwspMEZto6BPgUNlFpPhKa4J8b2bTWA/2Rl
ZfF4pgvqp9C/mlm/AMeTkuhQfDxf99KltLSUTp44weOaOZBrh9x2KQnGzR0R
EdTW1jbm9ZSUFPL18eFrrcDLy4u+mT2bTjB7decs6enpFBgQQP/euaO4beMh
1w657VKSQDZXwXNHm959xr3zZnajJgCs9/Cgb+fOpWVLl1J5efmov51ic2/U
pd6ZAtvGQ64dctulJMZoGbZlC9mvWsXvedOIj6ihpRw71NJy4YIFvMYUczrp
Qq3uageHMVruj4nh9Wg21tY8NmHerYaWcuyQ2y4lwWfa2dpS9J49vC5XulDf
48Tmdrpaxu7fT48fP+ax397OjvsYYry5tZRjh9x2KQk+M3zrVu4rmMtIF/Jg
qEnT1xLjIubN+B4+hto0NbT8lB1y26UkxsRLqQ2I9xUVFWSj0XCf0bq7q6Ll
RHZM97FHagPAnDz+4EH6bt48XjuthpYT2WEpWr548YJ/RZ0a6ilX29urpiVs
QB5U3w41tBwaGuLPaPrPfIgteE/K7eD/Us4RzxjI6eIZA6+jJtVctZO6dgDU
zJVcu2Zgh9x2qQ3yunh+MNdz40TorsNZIkJL5RBaKofQUjmElsohtFQOoaVy
CC2Vo6ioiJKSkkZzh2qCXCZqkywNvh+nspLvEfX09KT6+nq1TaINvr7k6OBA
11jfxPOMJYB1EzyvIV+1MzKSjiYkTIt+uZX5OM6ZwDP2ltBQunfv3rR5PtRH
qqdycXLi+dburi6+L9mbaYr6Kv0zCswF6juwrx+1CMgPIN+CGgfYibwRch7T
Bd16Kqz1P2hs5HkB+DnyBZcvX6aVGg1ZW1lRQUGB2fYz4rPLysp4rSHWz3Ky
s0f3o2MNHff6yOHDPH9+/vx5vm9dTSaqp+pi9zt6927y0Gqp4NIlXqeBfHZQ
YCBfT0V7pgqcMxG6eTPfM13O9LxSXEzr162jbeHhfP8vbJTqvOqZr+NnsX6L
Nox3LsVUMlE9FfpdxtmzvE4IOUDU+UE3vD/AtP6L9U2clxGzbx+1661JT5an
T5/y+Iy/j3N4epid+Fxc2Mf/Z1YWtyuB/QzWgQB0xViEM2Y8Rvb5415M9f50
aJKbm8v9AutRj3TqqfDZ6APItUZGRPCxWzd/qPs3EDsxV0LMyszImPT5OIgp
6PsuTMMDsbF8PjteLQxew77puAMH/q/hZG2R6hCgN+5FBrMHa2ZJx45NaYzv
7++n/Lw8qqurG1NPNepTbN6BtT7YN9F9leqp4G+YQ8O/Ktjv4W8aC+IF5jsh
wcFUXVXF+9hE9UQGNZws7mA/tVTDia/IsaMOWf+MCiWBHbi3kk64j4nj+JRc
JP9Cf/b08OBrBdgfLse/MP7uYfEYaxF/Fxbyvm2MX+rWcGLcxBkKmLuhjdK9
Nsc5FNDTwKdGxm5TkOJZZmbmqH/1fMS/PhaPTQWfjTPi0k+d4vMmnNmlX6dl
CnLPo8O+ENQ/oG7pUz5lDJJ/YVxC3EUtpTSHkhuPTWKkH7a0tFBMTAw/+0jy
eVPO6DPmPDq0a6p8QIpnuE/+I3Oo7AsXKJjFNrnxeLKfLcUpU8/om27n0fF4
NjKHQl+4wObTxsbjyWKKJtP5PDrYPzTSDnPW+5qqiTiPzhBTNRHn0Rliqibi
PDpDTNVEnEdnyGQ0EefRGWKqJuI8OkMmowk0Rn4BuWc87yKXgfnITOuPuiih
yXTfu6UGQhOBQCAQCAQCgcAy+Q8sueNT
"], {{0, 88.}, {83., 0}}, {0, 255},
ColorFunction->RGBColor,
ImageResolution->72],
BoxForm`ImageTag["Byte", ColorSpace -> "RGB", Interleaving -> True],
Selectable->False],
DefaultBaseStyle->"ImageGraphics",
ImageSize->{46.51171874999994, Computerized},
ImageSizeRaw->{83., 88.},
PlotRange->{{0, 83.}, {0, 88.}}]), !(*
GraphicsBox[
TagBox[RasterBox[CompressedData["
1:eJztnQeQlNUSheW9hwWlZBAByRJERZCMCBIkJwklIChpCZYEyUmyQgEqIDko
SVDJUJIRlAySg5KDkqMSldCPr6uuNU7N7hJ2mX+GPlXjlLszy/z/7dv39Olz
72Rs2Kpak/888cQTbePd/U+1Bh2Lt2nToHP1xHf/p2bLts2btoxoXK5lu4im
EW0KNvzv3R+WvftYfvfxv7sPMRgMBoPBYDAYDAaDwWAwGAwGg8FgMBgMjzXu
3Lkjt2/f1ueYeJ3B4FUQu1evXpVffvlFli5dKps3b5aLFy8GfO2tW7fk999/
l5UrV8r27dv1fQZDqIE43r9/v3z44Yfy1FNPSdGiRWXu3Ln6c39cvnxZxo8f
L+nTp5e6devKoUOHgvCJDYaHA7G9b98+admypcSJE0eSJUsmTZo0CRjPxPzY
sWMlderUUqtWLTl48GAQPrHB8HDwj/knn3xSXnjhBfnss880xn1hMW8IB7iY
b9WqlcSLF09Spkyp3KVEiRKyePFiuXnz5j+vtZg3hANczLdu3VqSJ08uFStW
lHfffVfjulGjRv+Ka4v58MXff/8t58+fl5MnT8qVK1eC/XFiFb4xnypVKmnX
rp3MmjVL8uXLJ9mzZ5fPP//8H45jMR9+YPzPnTsnq1atkkGDBkmXLl3ku+++
kyNHjsj169eD/fFiBf4x/9FHH+n1du/eXZ599lkpWbKkchxeZzEfPkCjZjy3
bdsmQ4cOVb0ufvz4+siYMaPqGAsWLJATJ078i9+GA/xjvmfPnnLjxg1Zs2aN
VK9eXfl948aNVcexmA99EOvk7wMHDsiUKVPkrbfeUq2OR+7cuaVYsWIa8wkT
JpQcOXJIt27dNBYuXLigvchwQKCYB3/88YdMnTpVcubMKdmyZdN1D64XXcy7
Pq3Be4CzHz9+XObPny8RERHy3HPPSeLEiTXWW7RoIStWrNA1fty4cVKuXDkd
Z2K/YMGCuhbs2LEjLLh+ZDHPz7n+Xr16SZo0aeTNN9/UXtWoUaMCxjyx/uef
f8quXbuUGx4+fFj++uuvYF2WwQeMJfUp49K1a1fN3wkSJNBc1qBBA/n+++91
7JyfhHV+z5498sknn2i8o22wDlSoUEGmTZumaz6vCVVEFvPAcZwaNWpo3Nev
X19/HyjmySFbt25VrYe1kTyyfPlyOX36tOX9IIEYZr1mXAYPHixFihSRp59+
WvN7lSpV5KuvvtK1O9D48F5yOuNP7+all16SRIkSSdq0aaVhw4aycOFC5fqB
+vVeA5/RtyaJKua57kuXLsnXX38tr7zyimTKlEkKFSqkHN8/5vmbeBiofTNk
yKD3J1euXNKnTx/18PB3DI8GjNu1a9d0XCdMmCDly5fX8UiRIoXy9X79+ulY
3YtXkNewRsybN0/H/Pnnn9e/Rd8SjWfdunX6e695Dl3dAt+As7HGnT17Vn8X
Vcy73/M+fs4aFzduXF0XA/F5Xnv06FEZOXKkciHWA/hi8eLFZcyYMbJ3714d
C0PsgHGGTx47dkxmz54t7733no5BkiRJlLO3adNGNm3apK+53xglp1ELTJo0
SSpVqqRrBbFfoEAB1bPhtP59+2ABzsEaBGdr2rSp9lhLlSqlHkoQXcwD7tHa
tWulZs2aGvN40aKqYeFE3ANqgbx582p+eeaZZ/T9jAXzgs9liDkQk2fOnJEf
fvhB2rdvr1zdaS/ojnAReM7D5mNigdyFpoG+ybiSC1lL0IGCyfW5B+Rycjp6
E/eA/EyfCQ8l3mHgfJVt27bV+QAX8YfjOJMnT5YXX3xR80a9evX0+ng/1+gf
w45L8u+jCbAW8j54z/vvv69+ZOP6Dw/uH2ND/h4wYIDmXWKdsaQOY8xOnToV
o9zD+c83btyo8wvemzRpUs391MSLFi3SNeFRcX13D37++WcZOHDgP/eA2qNq
1apat5D33T3g9dQx/Jy6kx5cIDCHyOvUQviIecZLT9zPmTNH8wv31r9/wXUT
2/R269Spo2MB3+E+9e7dW7Zs2aKf12t80OtwcYe+gn5ctmxZ1VbIu3il8Aii
wfO62Lq3juuzhlDXZs6cWceWvNqxY0dZv3699nhjC+4esO58+eWXqq+6e/DG
G29I//795ddff9WYDHQPnK4eXd7l98Qxz/A3+B25m7qe+tX1L/z/Df5d6gK4
funSpZVHkRvg+ujBcFBD9HDcEX44ffp0zSOMMbGGX6RTp06a8x/lXjbGlvw3
ceJEzatofKzp5NtPP/1U5yVaaEzB3QO09BkzZqg/jJzu7kGHDh2Ui1PDxvQ9
4N+Fozgtk/WkcOHCMmzYMOXz/v0LpyfQ74brc0/gglmzZtU6yPfzMa94P2sH
84G1kv1bj3MdQGyxZlKL4YNFE0Z7hDeyRuMRYUyCtWYyNuRVOBb6kC/XJzfC
CR7Ww+N7D6hB0RJ97wG8KjZi3RdcJzUw14mOSb3KdVLb078gt/vXNI7rM18Y
u2rVqim34nr4e3At5in3Cf8P/B/v25AhQ1TzDxVdOKbg+Cr8+eOPP1YNBh2B
9dVx9kBrazDgdP0NGzbomDmuny5dOuU/aCnkr/vNXdwDrhG+5H8P8MhwDx6l
Zup4FddJffzyyy/r2sZ1urlHHPvHKdfBnCT+mResAeyzhee/+uqrmieYx9Tf
PNMXYD7TS2S9DPf613evMlovnBAdAu8f/P2LL77QNdCL98FxfWKcXmaWLFmU
e6AjwT1+/PFH5frRfXY3h+ANw4cP1/WDvO6Ve+B7nXAsaho0XLQetCP6F8zV
QEADo19IToeb0c9q3ry57r+l/oXzo7US8+gD/C5cawDffgp8Fc2A2ox8iReA
e7l79+5IazMvwZfrs/bDgZm38G70TsY8ENd3PJg6/JtvvlGdG/7Aw4v3wF0n
fAWPBtfJHIfr41UiR/tyfebKb7/9pmsW8U4/Cy2IHOd0B9YI9Gf6iqwB5Avq
hlD2fQSC66fg42Ves1YSI2gE5AO039jmq7EBrgtNnDh/7bXXNHbhAvSKmA/8
znF98h/xQ+8XLwtaH7kTPgOH/+mnn3Q+ePEecJ3oSGhGcH3nVapcubLGtDtT
hNjG68e9gP+hOwXi6/yMOoi+GTEAXyQ+wgHOB7Z69WrVv+CHrOFwutq1a8vM
mTOVC3hxnO8HxDW6Ev0g1nJiGQ3vnXfe0ZggH8J7OnfurGMMZ4cXwRvoZ3ql
bokKjo8xlvSm4DnwcvYgomvye/I385/6l/GN6gwR5hFrGusd9QO1QKiDeGed
g7PT20T/Ig7gq3BYdEkvcvYHhetxUufR20S3I/aZ3/AfvHDEOhyW/Dh69Gi9
P16PdX8wZvSFWa/Qavr27at6D+MNZ8MLQsyjL9/LtcVmr+VRg3UanzY+DdZB
xpw6nnqeOR4u1+kPxh4tmvyFdgePY58WfIBaFX4A5wn1sXaf3z0YU9Y6eius
YeiRjxuoSdBm8ew6vko8hPI43w+o/1jbqc/wceFnQJcN13tAvcL1wefQZOjT
Piic9ycU92+yDjL/wzmvRwdf71Y43wOuD8+N03AfNM+7XEEtTA1k/jWDV+G0
GPoU1LbU61H1WIlj6lZqAPRrp3ni/UHzQtdy/jV8duZfM3gNxCMaHD5N9jdQ
x1OjRwa0LjyceFbRKulpuJ8vWbJEvR1oHmgf1EHU/HhAbK+KwUsgXvGjotPR
d6CXFajXRI7Hq8HeZOYHPgv24jtQG6DvsgcADcT17XgdvVzbq2LwCohlfATw
EXq27E9etmyZ5n/Hc4hnYhYNO0+ePKrlsq/T36fnzipye5fxctMDRgejr8ne
SPQx4/qGYIO8Tt8KXwX+Ifq26LPwFeKX2hTtnt4c84L4JafTw4Wz+2s1xDS9
Lnp7aEJuXzr9TXzM7rsljOsbggnilzxMjLK/Hl8lD/pxPNOv4Ywp8jcxS4+L
OTFixIgo96qwtwBeX6ZMGeX6+Dzg+pzVA9e370sxBBPEKByGM9Toz9CLZq8b
z/Rqydv4kuHl+EubNWumHizWBXylO3fuDHjWFhwI7g/Xd+cUoROxruBlCRff
jiF04fq0br+i2+vmv4+XvaD4NfEtuLO2mC+R7VXBt0qf051TBNfHn88+Latv
DaEANEjn04P3EMP4kfGgurO2AnF9eBFaDt50/C1wfOfjdv51+lr0AeA/PFP7
etXDani8QAxSjxLjnGPEXhV3tgtnbeFlwafrDzQh1grmDH0xt08BXxN8p0eP
HuoDwgOK35N9iuzhYA6E69nshtACMYx+Tz+WOHX70uHveBr896r4wu3RpYZm
3ya1LnyfeYPPm2d+xgMfFFqqV87tMhjc2ZnsS4fro/mwr873XF3fM5Odps9e
evzaxDrfNUG/AI83GhFnCrBXhb/H76mr2ctkNYDBK3D7p+EteHnQ5Yl7cj95
nHzu9mkRt3jV+W4JegP4GvC9+fN2eA/179tvv619YJ5ZOwwGLyHQWVvoO+y5
dWd2wmk4V4Q9XJwtwHyIDMQ9fh98PfhAObPIcr3Bi4Drs6+YPeTUo3jZ6Gc5
3wPnh8CB0H+i4unkfvQbfA9o/Hig+X+DwauA6+PjIc7h9M6/j97DvkzOZYgO
1MHUBej71MrseTEYQgVojnAcOA36Dpr9vbyHNQJ+RP+X/fgGQ6jAP37vNebd
PLnX9xgMXgH+BFeTcrbWt99+G+17qGM5qw2fGj1cPJ8GQ6jAdz+u4/PReevx
KLCvBe8nfB491GAIFbi9V/gt0dw5Hy8qHYbX4012Og8+/tj8XgGDITZA74o6
NH/+/LoHi7MDIzs3FI8+38Xy+uuva5+Ls2PNc2YINfh//zP7cvEjo2fC3cnt
PPMa4h0PA74b1gT8lgZDKAKtnrNBOC+fuMdT/8EHH+hZ/nhu+E48zhzErwwH
4sxQ/JoGQyiDfhX+Gc42h+O47yjivFD20rJHke8D4mw5/DkGQzjAeYo585i9
huR2PGfsq0LTIbfH5PeBGQwGg8FgMBgMBoPBYDAYDAZDbOP/R7aOxQ==
"], {{
           0, 72.}, {189., 0}}, {0, 255},
ColorFunction->RGBColor,
ImageResolution->72],
BoxForm`ImageTag["Byte", ColorSpace -> "RGB", Interleaving -> True],
Selectable->False],
DefaultBaseStyle->"ImageGraphics",
ImageSize->Computerized,
ImageSizeRaw->{189., 72.},
PlotRange->{{0, 189.}, {0, 72.}}]), !(*
GraphicsBox[
TagBox[RasterBox[CompressedData["
1:eJzt3WWUXFWzBmDWd++P+/P7xx/cJbhDcHcI7iQQgiaQBJcEd3d3hwDB3Z3g
7u7uvm+efdfm9tdrMpaZ6dM99a7VkMx0ZvY5vWtX1Vtv1Zl+yIhB2/1riimm
GPU/E/8zaPCey44cOXjv9f498S8bDB+1w7DhQ7dddfjoocOGjlx0yH9N/OKQ
ia+3Jr7+e+IrBQKBQCAQCAQCgUAgEAgEAoFAIBAIBAKBQCAQCLSBv//+O/3+
++/phx9+SF9//XX68ssv01dffZW+//779Ntvv+XvBwKBnsEff/yR7WvChAnp
sssuS0ceeWQaM2ZMOuSQQ9IFF1yQHn300fTZZ59lmwzbCwQmD3zYm2++mc47
77y01VZbpaWWWirNPffcafbZZ08DBgxIiy++eNpoo43Scccdl5599tn0888/
N3rJgUDT4s8//8z2dthhh6WBAwdmW9tggw2yjzvhhBPS4Ycfnrbeeuu04IIL
pnnnnTftuuuu6emnn852GggEuo4vvvginXXWWWmRRRZJCy+8cDr44IPTI488
kj7//PP066+/pu+++y49//zz6bTTTkvLLbdc9n0HHHBAevfdd9Nff/3V6OUH
Ak0FPu6JJ55IgwYNSnPOOWe2t7feeit/vRbyNzZ46qmnprnmmistueSSafz4
8enHH39s0MoDgeYEPvLSSy9N88wzT1phhRXSww8/nDmStsCnPffcc2mzzTZL
c8wxRxo7dmz6+OOP+3jFgUBzg80ceuih2cdtu+22Oa9rD59++mk66qijss1t
ueWWHb4/EAj8J95+++00YsSI7Of233//9NFHH7X7fnU7flFOt8oqq6SXX365
j1YaCLQGXn/99TRs2LDMR+It+bH2oEZwzTXXpNlmmy0ts8wy6cUXX+yjlQYC
rQGx4U477ZT93EEHHdRhfib/u/jii7PNhZ8LBLoOsSSuEhe53XbbpTfeeKNd
jcknn3ySjjjiiBxbqtnhOAOBQOeB67/22mtzXU6seOedd05SY0IbRheGt2Sj
nYlFA4HAfwL//8ILL2Sfhbvcc889c47G7mr9nfrBe++9l0488cSc+6mN33bb
bZXXgLkGZ4V1iou9nDOhGQ00Et9++23WNPNz9F377bdfuv/++9MHH3yQ6+By
PFqv448/Pi299NJZG3bggQem999/P+9bdmtP06tUqfeAremLcIY4Hy655JKc
i6rlP/PMM/naqrTeQP8Bm2FfJ510Ulp++eXTAgsskHUpo0aNyrzK3nvvnePJ
RRddNNvkHnvskfds0VvyG7Riaghq5r/88ktDr4cNWcNLL72UdTN8+Oqrr559
sxfuR23RGfLkk0/msyLsLtDXoPX68MMP05VXXpm233773EfAn4kjcZpsbZNN
NsmaS36DDrOAH1QnZ698pJpfI3WY7O2xxx5Lu+22W163mHmNNdZIO++8c9pl
l13S+uuvn88Vr6FDh6Zbb7017C7QENhzfBabuu6667J9HXvssdn/sUW6THro
n376KcdtBb52yimn5PoBnfRVV12V93Aj4Ox47bXX0ujRo/N66Nn0H9133325
FomX1QdI082XzzLLLNkPPv744/2iT8JZ6Dojn60eSo5Gd1JszOekl+DBBx/M
db2yR33dnt1www3TtNNOm7bZZpvMy9TaZV/hm2++yf21/BsdtvxN3lbrd+01
OewNN9yQ40x+EAerH7dVUT5PObg8QJ9IbawSqCbMapCzbbHFFrmnrraXx/fO
PffcHI+qI5xxxhnZ//X1WVp0NXwcDrbwPG2BjR199NFpxhlnTGuuuWbeh/X9
FK0AZ6L4/6677so9kfy7Xix1nvB11QYOkC3xC4sttliON0sMyfZwFurqfN26
666bz9O+jNfsH3kcnmT++edPV1xxRfbTk4K9aB+qTYqJ5XVVr310BeIMZyHO
WXwtp51pppnSzDPPnHbfffd85oTNVRvshx2JIaebbrrch8DOim+wv9XX8Zvy
JPEanUtffa722O23357PhCWWWCLHux3Ft3ybcx9XdPbZZ+eYs9nh/PNZvPrq
qznOHjx4cI49pplmmnwe0R3JzftD/toKMKMI/yCGxGf6M/8HbOudd97JMd30
00+f+Qs20Fe+wx66/vrr0wwzzJDnudCCdmTvr7zySp7/Yk/ii1xfs8K1ytFo
F+SqeFs+XNyx0EIL5b/fdNNNuS7UijF0q8JnxTfg2H2WePdazg9PL15bccUV
s93hD/uqdmAN6t3iJ/wJHqej38tPb7rppvkMobERizUjxMm4Ij3Haqr8mftf
dLHycHzupPqRA9UG/dTVV1+dczpcBc1zbQxJB61eJ74UZ/ZW7YD9q23gKtm6
/XTPPffkupvf68/tcXPW67zgj/0b+Wlt/icuxdlWWaviHoiHaRFOPvnkPDtq
1llnzfa21lpr5br/U0891VJ5an+E/aefgB5FHMen3XHHHf98rvaqvcwH8oX1
ed/kgu9iC+oVYsnzzz8/62LYHR8s3+S3zCxrjztlr3gWvoDuDf9S/IC14jxd
l2vBN1TJ9qzDPcDT0rSJO8T67jd9Hm2CM6e+ThJoXtjf9iN7Y3fsrzaGFKOZ
lSmPWHbZZXtED22f2ff0MvLEvfba6x8tlzqc855tyMvkZ7gRtUS2VW8rfo45
nTvssEOORf1f7aO8j7+78cYbs/2KPdX88X+uqxF1x/q1iyvcf/ddvMHW5ptv
vqy1cQ65lkavM9DzUPMRV4ohfe61MSTbo/nAXcrp8J2TU4Plf/gsvsjvXG21
1XJdTWzLj957773Zpr3PezbeeOPMX9J60aDYo2yy2CXeTo2KbfILet9r40o+
xDmBXxen2c9q/WwbH+i9fe0/imab33UPaEjdA/ffuYB3rdflBVoL9jcdVYkh
xTe4whJD+uz5PlyGnKs7e9S/KfM1Tz/99Kz5NP+IHay88sp5vjsbYwPFR/ld
7F+dWw3A+vAKF110UX7JNdX1+WA1BXVxXF69VkVchv8zQ9d7/U7vHzlyZPaB
+EH+vrfjTeuSQ7uP6qPsSzxsPezOPfA5OE+qEvsGeg+ldiCXwFuIa3pi5qW9
w2+xWTW/HXfcMde52Tb9tXrEzTffnH1tfZ5oj7IXmlHnAL6czeBKvNS/cSb2
rvhXbjqpOIxN8WsXXnhhrinY62LplVZaKde5HnjggV57hkO5B+ov48aNy/eA
v1VnE1fo99BjjLMK7r//wGeNH9H3gzOzz53JkwP5Clu6++67MxcgH7TP2TWd
y+WXX57j1o5iKLaPWxEP8nPDhw/Psea+++6bzjnnnOwf5Wcd+V973zWJR485
5pjsW6wHP8iH6hcquV5P7f1yD/Ag1ovjoUPADZV7gEMK7r9/Qu4j9mMj4q1a
n2EP8hX2rBhRDNge/8eO/Cx7G9eN35CveD6J2JIN1caRHaH00tEW4vjUqMSR
7LGrsa5r8XNwF+xADZDfFb8OGTIk9/36+ZOT6/kdYmP8vph37bXX/kevhc9h
37iftnihQP9GqRvZ5/gNtS91WXEi/zKpfY+TlJ+U/ElPnmdxPfTQQzmOrQLv
zbeI9/AuZqaxOfGeXI/WQ8yrztCVXK/otdisnFMciwPi26p4DwLVQul/xWOY
V4uzx+fLgfwfp0jfLhep30M4bnnSOuusk/lOuhL2WUXeW64lrtZPITcUa/J7
uJ36XG9SKHotNoqXwdfIi6eeeup87uBr3AP3M3K2wKSAz5ZDrbrqqpmLZ2v4
fByAGQ/8ga/jIGn5azl6vk9sid+XszV6zkNHYDNiZr5bXdA1y/XEw3I9dT3x
sHix3mZq9Vrm16t18mt4Grwq3gZ/E9x/oD3YV/gE+ZfaGT9HV8uO6InlKXQT
+BZ5Ck4DN9nsuUnhStXqzaB3rog38T5yPdfsDCn9v0WvpRdfnsbOSh+fvht8
jRy42e9Lo2AfutfO8yrGSD0JfkksZK/hs+md689pfoHmioaEbdpfrcK/lV56
elSakJLrqW/oWePX+T25Ld+P+y96LfE2Hir0Wt2H+yZWcr6513h0570zrlVj
czmOGh1OW11MjiJnc9aUM9t9kZ/gU7xaUafk7KEPUJOQ6/H5Yk71QeeM84gt
skm6M/ehnvMNdB4lL7av6IfUb8XquGUztXALait8X6vFDrXPkMQp6Jd0pos3
7Sm5XpnpWl6teqbX5nqlridfm3LKKfO9kc/SEziH62f4BjqPkhfTF9Zq4qaa
aqr8KnEEfa46Dx0g+2yl+82u5P+uHVeinmt/4SH1m8jv6Ji8rz+c684h/KXP
2yxe81rwLfZIdzVxgf+7r0UXSBOHD6cLLDohsbq5PaW/CX+g5uve06y20v6z
h9SOxZi4bty5/E68Kabyd7kMjr0/aSlcp9iHDtm53Kr5RW+j9DHR7BVdoDlv
Ygh5M3+mRupe08XrLWF77JD/sw/xwnR/zn522+znnvWXflI1XjyKOi8+nDbf
3ARc+sCBA/OZ05czUwLNi9LLZb+o7dIF4uH4NXmx+KFo4mp5O77Mv2GH8jz1
T/ZJd0vTgGehcWiW+L7YV1kr7kDeRn/ijCnciXsgvhIH8H9qv/RMOAVcXdXr
cIHGwj6yn8SEzmmaOPsHN6XWQhdIE9eeLtAexGeqHavfDBgwIGudcC1ifnop
evEq9SbXomi7+Hf8XMlLnCc0gTRQuCJfr4dr8gwS9WN+3v1q1jkkgd5F6WMS
j+OAN99888wR8G00cWInsWNnNXFFr65OjFswE1LMxXbXW2+9PLPc9wrXXgXU
1j9oKPkrORstYPFxekxcg7PEvapfu5+Bx6TTcP/M7CizwwIBqO1jEhfpCREL
lphQH0vRxHXHNuxBe06MpXcZz8fniVHNbJIL0XCwz0blekWfT/uo1siu8K/O
G/7K1+S11qjerTanR80sLXYnLpCr8nt0J/JX75HT6QstOnn+38+oqn8P9C5K
zlb6mMaOHZu5D5yjmMg5zh7wBD2Rj/hd7BoXw64LF2Nf0jDg2PuqN7kWzhE8
G1+m/mFeAX9Mr6QGYAZQqWs7E2gErRdXiUdyLTRO/KL7JffFXfJx/CSfWebp
i8nV0cWroTPsX5CvyDHEds5qNV7xEp5f3CcW9L2e1sQVHpRenS/AaerpkC/y
J+aL2Psd6dV7AmUugrUUPYW805nDZsTSbfWXsB3PdSs9Zvq7+UQzTJxZYoPS
90J773pB/iqe1lOA23W+NDuHG+gYtX1MehD5MjGeGErMV/gNsVJv1lfKs2PM
uTC/w3611/kG2vwzzzwz+4S29OqTizLLrtQ/6JDxq+4BWyk+t70em8IR+ffO
CdpD/c24WT3b7i2Nb7E3cI7Q9zrb2Kp/O7k954HqouQrzlb7yb5SR7LP9DGJ
j4omri9ruPa02LbkUNbE9uRCdHpyJ7x8T/QN12rW1D/o43FDfh8trtkiZR5w
Z2Np90p9XD6q/uj/bBW/ySbFrMVu/W4cFC5JPqvW6f1RO249yKPENfhr8ZK+
SvtMHOUZuPIV8VUjZ+Haj2p9ciK2xgbU1PneffbZJ+uK2Ep3dWRljlvpA1P/
EEfXz/zoiVhaHFF0qOJn9778TPGD38Wf42BoVaKO0Doosyf0Vvic6bLotdib
WI4uVQ2uKjPMynNQxZQ4CesVh3nJgcRlYlG+o7O+uNQ/+JMy2wr3wZ7Vq8WB
PR1LsyGzGP0e55uesxJjsn2fB200bSqOhq33F31Yq6K+xkQz4kwVz8gj+A3n
cFVnmFkTGyh+GZ+BR5R38st8Q0c6str6R3mGi1yNrdFE+ru6iFi6p5+ZVJ4j
Yt1id3G83LGs1Rkn3xM/izXwKs6RKpx7ga6h5GxmT8iPaCHFZvwam5M/0E74
/Jvh2VzOfrkRHZl9i5dnM/gO+SebaUtH1lb9Ay9a5lfxd7j63tKf+Zl+P25I
7FqeH1n4ErYnR1VrZ5N6p+V5UTtoLtifeLHaGpN9hofHgetjqufRmgX2Il6D
rYjJxGyujR/Bs7Ite9y14fVr6x9qbHyk2NTXcPz8TG9z9GXGuf7Ntp4jYq23
3HJL1rA6E50NzpfwddVHyVdqe2xqa0zszwyYzswWrTKsna3oF621J2cKDsQz
auRN7LLMBOATzWvFT+Ip8Yt9GUuzf3U/+gLrwaf4HNiVFxszP8s61ffwyT0x
IzrQu/AZyXvEKfIDOVuZTeEz7K5eq6oo/ZF8Gx9X/IS4UQwp7vR3dWnxpxmN
tFiNiNuslS5MPu1zKbNRSlxftND4LL5QnZA/r2KOHfh/2H906+pacjZ12TJv
t5XzgzILp9S02Zh9zafgWUq/XqPnAasbsHtnAf7V7OLa2gHuBIfiez6/8syr
QHWBu1O7oiUSx+CduzJ7u5lRagtsS0yJ93f+yKOqMhPAGvlZfBa+RO0Ap1lq
oXya2gHtjZk9NN/qGlVYe6BtlDxHbtAbOqlmQNFNiqOr1BdUgEuWT9K8sDt6
G3xrbe2A/kVOJ0/F81TtGgKBZoPzwEx+uaY6Ya3Wku2p7+hJ4K/9OfxcIDB5
wJfgj9Us9C+pleoJKnFJ6UuvwrOFA4FWAb2nfgm9P+JMeXgjNa6BQKuDL8OP
qBfiWsu8h0Ag0Hvg18SUEyZMyH4v8rZAoDEounS1O3pYdqnGqgbJNqPvIBDo
OeBX9DfQpdNFizvpSs2npSfSF8QvqoP0x1pQINCTYG+0z3oZcZp0ezQ1ehG8
/Fndjv3pmaflDrsLBLoHtqPHUd2OfdGHqSHoATHv2jPe2CKdJk2bZ5KonYs1
+4POKBDoaYgV6UL5NnVyffB65MuczzIDUB+7eLPMkYheu0Cg6+Cn6ETpLPUk
mbWLO2krblRP0Eeh/8B79Wfpow8EAp2HPA5noj4urlQfb69Wh880p4J2TKxp
XlPEl4FA50HnZa6LeNFz+syKaM+G2KNZFHp0cSr68EIjFgh0HvI0/Ii+Of07
+gzaA3s0E1qPHS5TP1DkdIFA52FOhJ5H+ZlZtupz7YHN0Yp5xoN5AOZQhG4s
EOg8cCBmuPBznjnWUX5Gh8LO1AxwnOwvtCmBQOdh7pf6mxlmegw87749G9KP
rCfBvDMz3eR/odUMBDoP9kLP5dkFfJdZZuLNtnwdrsScRDEozmX06NFZjxII
BLoGNqYObmaZubK0J2ypPA+yPDeM1tmzWtUVzAgeN25czOQLBLoBsaTZJ/yX
+ZflWSV0JjSYZpaq4Y0ZMybPdcOfmC9YO0slEAh0DXReeH/aLtyI2hvbUz8w
M5D/UzM3x9NcM9qwqBEEAt1HmRdoRiIfx9Y8L4gG0zOf6ZpHjBiRewrooZvh
OROBQDOAzlKdHK+iJkBzMn78+KxvNs+hv8wsDQQCgUAgEAgEAoFAINB6wGng
Pryajd+wXjW+Zlt3oG9BA4VX9zyQ+pe5kX05m4emXx+pZ+7g8HGOVe9nK89Y
t256TS/3LuyuffwvS0EfNg==
"], {{0, 98.}, {221., 0}}, {0, 255},
ColorFunction->RGBColor,
ImageResolution->72],
BoxForm`ImageTag["Byte", ColorSpace -> "RGB", Interleaving -> True],
Selectable->False],
DefaultBaseStyle->"ImageGraphics",
ImageSize->Computerized,
ImageSizeRaw->{221., 98.},
PlotRange->{{0, 221.}, {0, 98.}}]), !(*
GraphicsBox[
TagBox[RasterBox[CompressedData["
1:eJzt3Qe8ZlV1Pn7/aoyJyScaiTQpAlIMHQSpglIEBASlE6oDiIB0EQlFAYNB
kJIIOvSiIiUgbQQp0jvSERDpCIEgASkp++d357/wzOt9Zxi4c99z3lnP5/M6
OHdm7jn3nP3stZ71rLU/stVX1t3mne94xzt2e+8f/mfdLb+64q67bvm1z7//
D/9nvZ12+9K2O4374mo77T5u23G7fmKrd/3hN//3D5/3/n/veMe7//BrSSQS
iUQikUgkEolEIpFIJBKJRCKRSCQSiUQikUgkEolEIpFIJBKJRCKRSCQSiUQi
kUgkEolEIpFIJBKJRCKRSCQSrccrr7xSHnrooXLjjTeWxx57rPzP//zPoC8p
kUgMGK+//nr59a9/XU466aSy9dZbl7XXXrvsvPPO5dxzzy3PPPPMoC8vkUgM
AP/93/9dnn766fLTn/607LDDDmWxxRYr0003Xfmbv/mbMtNMM5VPfvKTZf/9
9y/XXHNN+c///M9BX24ikRgD/O///m/53e9+V6677rpywAEHVB748Ic/XOab
b76y6aablj322KPGELPNNluZY445yjrrrFOOOuqoctddd5XXXntt0JefSCSm
El599dVyzz33lKOPPrqsu+66Za655qrcsOaaa5Z/+Zd/Kbfcckt5+OGHy+WX
X17222+/sswyy5Tpp5++/P3f/33ZYostyqmnnloeffTRyjGJRGI48F//9V91
XZ9xxhll3LhxZf755685xHLLLVdjiCuuuKL89re/rVqEvOP3v/995Ymzzz67
fPnLXy4LLrhg5Yklllii7L777uWSSy4pzz///KBvK5FIvA2oQfzHf/xHjQf2
3HPPstRSS9V4AT9Y9+edd1555JFHat7QGxPgCbrD3XffXY4//viyySab1Hhj
lllmKausskr51re+VWsdL7/88oDuLpFIvFVYt7feemv59re/XVZfffU39ISN
NtqonHDCCVVPeOmllyZZx8QZYo/nnnuu3HDDDeXQQw+t3CD2wBXrrbdeOeaY
Y8p9991X/1wikWg35Ahyg5NPPrlsvPHGZZ555qkxw6c//elyyCGH1HUuN7Ce
mzGDGMLf83W/ih8C/hzt4oknnigTJkwoX/3qV8uSSy5Zcw65x7bbbltzkaee
eiq1iUSihbCeaQgXXHBB2XHHHcviiy9e93m/7rXXXnVdP/7445U/etew/29t
0y0/+9nP1tzjzDPPrL/XhFhDXPLggw9WLQMv0C5nnHHGqmV8/etfr7nMCy+8
MJa3nkgk+sDaphNcf/31VWtcYYUVarww77zzlq222qqcfvrp5YEHHqj+yEnl
ErxQ//qv/1oWWmihMsMMM5Sll1668spll11W66FN4CK/d8cdd5Rjjz221kJm
nXXW+pHL/PM//3PNbXzPRCIxGFh/6pVqk3wKc845Z12ja621Vv292267re7l
zVyhH+QXdATr/Qtf+EKZffbZK8+sttpq5bDDDiu33357zTECeEks8uyzz5ar
rrqqHHjggeVTn/pUjSU++tGPVj2TJ5M38818/0QiMTqw3p588smaA2y55ZY1
xqcFqE/wPIrx5Rq9GsOk0FzvV199dTn44IOrZjHzzDNXDcN6p2vSJppxSGgT
ejbkNrvttlv1YopB5DY77bRT9Wi6ntQmEompB+tLvZJfIeqV1iF+2H777atG
aP2KK97qWmyu94suuqj6Ka1z/LPIIotUL7a6KB5pAmeoh9x///3VR7XZZpvV
GgcNRM7DbyXOePHFF0fjR5FIJP5/WLM8S7/85S9rjXHVVVetPgQfuQB/Ap8C
HWK0YvnQIn/1q1+VH/7wh9VX9bGPfazy0fLLL1/22WefcuWVV/5Jb4bvj8Nu
uummcsQRR1SvtjxFfdV/82q71vRqJxJvH9FfKbbfcMMNa6xvjUa98tprr631
SutyasTvoUXiJpqGNR7ctMYaa1RtwtdcZ8B1WP9yCrGOnAen0CbEOqGb8mal
NpFITDmiXnnhhRfWHF5s/6EPfagsvPDCZddddy0XX3xx1SBG8j6ONkKbiPUe
fV14au65567axIknnlh5rFebkOv85je/Kf/2b/9WcyDeTTzBP0GrcB/8V4lE
YvKwpuTo+ivtu9FfqTax+eab131Xji/fGOsZLrHe7fs0iF122aXylb7w0CbM
jcAjTbhO93TnnXfWXIhvi5eT9rnyyitXr/bNN9+cXu1EYhKw9u69997qQ1Cv
/MhHPlLXEE+BXJ6nwDobdEweWqR66CmnnFJ7O+U9NEx5xL777lvznuZ6b3q1
eTXoKO4L99Ex119//Vpb9W82c5VEYlqH9aYeYE82wylicB4luv9bqVeOBVwP
LRJv0R1jbkRTi9Tn0ezNCG1CbqQPNLza6hy82l/60pdqPTRzjkTi/2AvvvTS
S8sGG2xQ1wkNb7vttitnnXVWzd3HQmN4q4j1bhaVesY3vvGNmhO5Dx5OOdFp
p51W+8ub+VDUR3g7w6utPkL31Pf185//vLX3nEiMJdQfxo8fX73N1oiYQa6u
dtiVObGuM7RIcZAZlosuumiNgz7+8Y9XrYLW+u///u8T/b2oj9Af5CW40Syr
4447rjP3nkhMTVgzaofWhj4nvsipVa+c2oi5EXQUPaS0CXEEnWHFFVes8QVt
QswUcJ984PxdYg+6Cw1m0DpLItEGNPnB+lALDIjd1Q3F23oguqDdhRYpLhIX
HHnkkbUnRO6gr4P2am4Er2cAp9Ad9HAkPyQSf8Sk+IH+J3/njeKH6u25bjOa
2oQ+UPnDsssuW7UJsYR4ITgg+SGRGBmT4gd1C/3SCyywQJ3LQM/rGugIMdPy
nHPOqXMifPRjhMaQ/JBIjIzJ8YO4gW6p9qcfoqsIbYKGiefERoHkh0RiZEwr
/BAQM/Tqr8kPicTImNb4YSQkPyQSIyP5IfkhkeiH5Ifkh0SiH5Ifkh8SiX5I
fkh+SCT6Ifkh+SGR6Ifkh+SHRKIfkh+SHxKJfkh+SH5IJPoh+SH5IZHoh+SH
5IdEoh+SH5IfEol+SH5Ifkgk+iH5IfkhkeiH5Ifkh0SiH5Ifkh8SiX5Ifkh+
SCT6Ifkh+SGR6Ifkh+SHRKIfkh+SHxKJfkh+SH5IJPoh+SH5IZHoh+SH5IdE
oh+SH5IfEol+SH5Ifkgk+mFa4Qdnej/22GPl/PPPLz/5yU/queSB5IdEYmS8
mfN5559//rL99tuXBx98cIBX+tbgPL1nn3228oIzhpdZZpmy1lprlfPOOy/P
500kJoNJ8cPLL79crrnmmnLYYYeVs846q7zwwgsDvNIpg7XvDN4rrriinte9
3HLLlRlnnLHGQrvttlu59dZb3ziDM/khkRgZk+IHawxHPP300+X555+f6Ezb
tsI1uubbbrutfPvb3y6rrrpqmWWWWcqss85a1l577XLssceWu+++u/6ZQPJD
IjEygh/mm2++8vGPf7ycfPLJ5bXXXnvj69ZbfNqO119/veZAxx13XNlggw3K
XHPNVWaYYYaywgorlIMPPrjGQu4X78X9+PW5554rp556alliiSWSHxKJBsTg
OGHRRRct0003XVljjTXK8ccfXx555JHOrBHX+dRTT5Vzzz23bLfddmWBBRYo
008/fVlkkUXK7rvvXi666KLyxBNPVP5o8hwevP/++ys/rrbaavXvLLjggvXn
0QU+TCSmNqwR8bb9dbHFFisf+MAH6hpRr5Br2G/bulZcF03kF7/4Rdlrr73K
UkstVeMFccOWW25ZfvSjH9V44pVXXpnoHvCJnOmcc84pW221VY2dcKP4wc/h
vvvuG+BdJRLtgXXz6quvlt/85je17rfNNtuUeeaZp/zt3/5tXW9f+9rX6vr7
/e9/P+hLnQjW/C9/+cuqMayyyirlwx/+cNUf1SZoDHfccUd58cUX36hRgHv9
3e9+V6688sqy5557liWXXLLGDO5X3HH22WfXuEmckUgk/gjriE4nlvj+979f
tTx7sTX3mc98phxxxBHl3nvvHfja8f0feuihqjGst956Zc455yx/93d/V+sT
9v7rrruu6glNjQHwG83yn/7pn8rKK69c+WS22WYr66+/fs2n7rnnnvLSSy9N
xCeJRGJiiL2tL1reQQcdVGsaH/zgB8tHP/rRsummm9bc/PHHHx/zdRQag5xH
jMOTISdYaKGFqsYwYcKE8uSTT9Y/1+SF4JPx48eXz3/+82WOOeaovIcj1G1v
uummqsH08kkikRgZ1gldwnqj7fELLLzwwlWb8OuOO+5YLrjggrquxuJaIif4
6le/Wj7xiU+8kROMGzeunHHGGXX9u97m+rbeaQxyhq233rrWb/EczdK/8/Of
/7z6v/gqkxcSiSmHdSMut/5OP/30Gj/wEdi3xRUHHnhgufnmm6sWMDVAF6Ej
0Bjs9zPPPHPNC8QB/XIC10x34IvaY489Kp/IP2iWtEh8wlvt305eSCTePqw/
e7j8/aijjqo10A996EOVKz73uc9Vv8ADDzxQ9+LRgJxArwedMXIC3+/Tn/50
zQluvPHGWrfozQms+TvvvLMceuihlU9mmmmmyifrrLNO1VTuuuuuqrGkxpBI
jD6sf/VOsT7PsnqgOof6oFj/zDPPrBrBW11//n3ahj1efdK/KydYfPHFy957
710uvfTS8swzz/yJxuDvqb+cdNJJVW8MzZIvSn/Z9ddfX/2fqTEkElMXzXoo
/wCfxLzzzlvXo1he3fCyyy6r8cabhXVLE7X+aR18nOIF/y4tEu/4fr05QfRe
8UarT/JtuA5eL9dx8cUXV75KjSGRGFtYm3J/Nc8TTjih+pnDg7DSSivVfZs/
wZqeHHDDaaedVn0MNAZ5i7xCDZPGICfoXd++txqLuEJPZmiWtMjQGHp9UYlE
Ymwh1qcF0AR4C1ZcccWqX9IMNtpoo8odDz/8cF+vtvUrp/jGN75Ra6g0BvrB
DTfcMGLdMTQGOgRfBj5Rr/zsZz9b9YrQGJIXEon2gKYolv/Zz35W64difNpB
eLX1RtAORoJYQB3kxz/+ca07qEuO5GPAMyeeeGKNVWgMeGjZZZetdZSrrrpq
RF9UIpFoB6xLMb11zKv9xS9+sdYVaQlLL710+cd//MeaE+CD3r+HD3BAr1YQ
vRI0BjyDb/CCX3fZZZfqw+DT6O29SiQS7URoE/IAvZFrrrnmG7VG/33kkUdW
H3ezj3wkmNGg9rDPPvtUjUEeIW7YbLPNqh9D7xV/RvJCItE9iAXUF66++uqa
A+iRUF+Ye+65yz/8wz+UU045pTz66KN/Ug/FG3oojz766Kor0CvxC98FrwXd
kwcqeSGR6DasYbG/+Qu82rvuuusbOQKv81e+8pXaO0GLxCf4Qi2DV1M9Qm4i
dqBf0hh657skEonuI7QJPks9XhtvvHGd1SRnUPOQQ8hF9HbgDfyhB2vnnXeu
GoMaR2oMicRwI+qht9xyS/nud79ba5Q4Iua6+HX22WcvG264Yc0/8En6GBKJ
aQtyCfVOXkv1UHOl/+qv/qosv/zy5fDDD6/8wYOZvJBITJuInIO3Sr7BA4kr
5BK9/odEIjHtAQeoU/I28EJ+61vfmmj2fCLRFtDF1c3kvOYKteXDW8gvoFY4
bHtqkx/4I3i0h5Ef1GzVcG6//faBv0/Nj559Mzen1gyPYQFuME+Itm6mgT6A
Nn3Mg9x///3rvJRhwrTAD7xiZvyq7epBG/S71Py4Hr35zhuckp7baQ18eJdc
ckk9B+Hd7353eec739mqz3ve857a7+w8TLMMhgXDzg90FPGoOeA8XoN+j3o/
73rXu2otmV+NVzVn5/wpPEP9wPoD5MDmGOy3337Vv9eGj/lqeiHV/fAXHhuW
PGPY+UEtV9+ZeXz8HltssUX1lw/6nfJxHeZkOPfELB59s3rsEhOD5mAGiR4i
NXhzm9Xe5GRt+OhL5BFaffXVq9fYvObm+fRdxjDzAz8XvcG94QYcL89wf4N+
p3xch/ka3if9+HKNCy+8cOBnGLQJdCPPcNttt63eHGcq0G3atD+L+R577LEa
R+hdcG7ND3/4w1Gb9zhIDCs/uC96ln4Rve4+ZmC2LcenjfC986mJT+VBw7L3
vF14hvz85orI7fUFfO9732vl+4nvr7322rLJJpvUdURT0h/ZdQwrP3heYgXz
MJ0f7v7MrmnTvgOux97j586jJoZ2LuEwPIO3C8/QPALPkDfHmjM3OUCXwPf2
gTczJ220IL4z80CvUnxfz1HOYw9yBoUzaPUrdP05DiM/iPc8O3mqfccMG2su
zih0z+7Ru2bWLz1prD78qrypzVq5d8zew9MufzXzU49s27hsLOEZqkebkyiu
8gzNLYzcS+wuzhIf6jH0sx0L+P56m+US1ox5TPGcfM0etNNOO9U96Qtf+EJ9
rl3GMPKD+Xbnn39+1ZLl9WZ9m6/b/Lr3yUxdvan08LH6iA/WXXfdOtvTvhcQ
RztTxExyZ5Idc8wxQ1Unm1J4B+Vdce4KjSa0W++snw0vhFnK5qv777EADrj1
1lvrfHf1MNzUzAfFM2eddVbtU/Du8UR0WXMeNn4Qc95///31bB6aJI7wnjW1
Inq4eVjmWfz1X/91+fM///Mx+/zlX/5lPUtMndzcreZ123s8BzGEM0PM+us3
N3SY4Z69k7QY85Y9Q+etRe2XZmmNmoVs/oDasJ/dWMA1eG7Ow5UP4ifcFO+X
a3ee1b777lvfPx4Xe1VXY8Fh4wdzLMy2Eo+qGVqHzX0aPEucbv2ZdeH5jtXn
1FNPrV4oc8d7PZP2HucRqsWa0yU/EmNPa1CTpv9be+oBnmHoyqE7OyfK19SG
xV2Tm4U2mvC9eKrxk9jGPDV8FbB+nBXBU4nrzWG0xrqIYeIHz01ub+6ms8Ht
K3rPRvIcuW8fXxvEZ6T9xO+LVeVD6vyf+tSnKpeM5bs/aMQztPZokmrS6psB
GhJe57FW79xhhx3qvNWxhGfH82D+wZJLLlk1Lt6VOA83tBMz3u1RckZnR42l
hjpaGBZ+cB9iAnGfOph9RY4vl+gSvP/2npjr57yipmY/zPAM6bY0R7GBmrRn
GHGWdadX5Zvf/GbV/8RZzpMfRA4mBhUD0kVci1zVcwvgAn5YsYUYg17R5Lmu
YFj4wbq6/PLLq/ZnXdGQ6cxdy/tcr73HfkSnsPfISXpnjg8joibtGdIV6MdN
7Y+uLJ5ybqNnbOZZb+44lrD3uB4ag+sR94WmFFwn97FXeZb2rq7tV8PAD/YV
9YkDDjig7ju0Y37cLsZzIMa295jJ4b1z7rmYu2tcNyUID+LBBx88UWwQul/s
13J5dQP67XXXXTfQn4m4xXtHJ6IXmf+sdhHX5Jr5Y8WAoTmrp3cJw8APONn5
P2ph8na9O2bcdBnqd/JbNVFzQPVrqIEOK5qxgfdwr732euM8p8j37cVyR3UD
vStteE/Frda8mIceYh2pnwXivsQY6hlini69m13nBxxtNoc5unw08nbehq7X
BV2//VJ93Xvl3BI1vq7f10jwDGksatJxVqM11/SPOe+R3ux8Bj12fjZtgLiH
7sUryTNptjPNJDRlz4t+av47P4S4SI2qK8+x6/wQPhk9MXI8mrG8bxgQe486
Bo7gteELHSZ4/+j+YiV6JL3f/FP3Hl+3/vyeGJ4e48+2qYcNF5jzo4eMFqnm
om4WaGpjcicz4ruiOXeZH+wrnoP9RH5HI1aHHpY8PXQVvEBXiZy8q7rKSLC2
PEM6f3idxIOBqOfoneaVEk+1jSOD43g2+GOdc21OY+SD4amSE9nDoi4Tfv82
o6v84Lr9zL/zne/UnzkvjRpzF659SkDTt/eo90ddhuY1DAivk3XTjA16Y3Ne
RJqkOIoXsY2xeeRIPJ+8N6uuumq5+OKL3/i6e9KXTmt2L86f4rFqO7rKD66R
zsCj5nnQiLvqUZsUIr52Von81t7jDPWu1clGgv2TpkJv4IUSdzdjA/coV+eF
lV+pT7VZo1WDNr8DN8gjzP6J+2l6qmjO8ih7W3iq2oou8oN4jcedFmzfsa+I
u9uUk44mws8rj8KFYvG2zUiZUkSPLd0uYgMzmCI2iF5InEGz1AvZ9nuOe9Jz
Kh+Ua5hd1qx3ijHwhlgwNOc2o4v8EH0K3in1TH66Zq/TMCL6SrxzoeEN0hv0
dkF/9Az1z1orZkvaXyHmwvzgBz+otUxxE09lF/J1+aDzsJszK5q9Y80YQ71N
HZcntK3oGj/YV8wQ57v3XsnL5efDPtfV/dl75FHqZHoazR5oYy4+OYTXSU1a
vVKOaE5C7zyMDTbYoH5dL4YZw11AaCr68/Xp82v476ZHXIxBv7S34UcxRltj
367xgz3mhBNOqHok35A+vmllTkLsPeZUyjP23nvvMe9NeruI2Q00FGund85S
9DaZv2J/lat3bZajtW62nNyIDiGWaM6Jac42Uw/lI2+r5twlfoh9hfbr3TFn
adjOI5kUPCt7j3xqnnnmqXvPT37yk06dreMZ8kXzCITXqek39O5NmDChciBd
QrzUxR53PeqeDW2VRuaZNf2g5tPJmXCkeXRmbLaxx6Yr/OA6+VJdn7Whr1bf
Uhdy0tGE9XXVVVeVz3/+8zW/irmaXUCsCx42/M7TZu5fxNYxW0VcxOvAL48r
upg7xr3QVdReVlpppaq/BsJTZY8TQ5gtqOembegKP+BW74pamHfLOcJdi61H
C/JbMbn81t4zfvz4ul+1Hc3YwPrXa9XUldUzzZiUU4THqO31v0nB/dKI9H7j
APeLMyA8VfhRX5c9T90jNNq2oAv8gItpczgBF9tX+GS6lJOOJuJcD3uPn4c+
T3tPm2t/4XWyn6pX9sYGzXMu6P72U/trl+HexLx8DmbI0MzEvKEpxxw9feH2
PGccmIXYpnipC/xgb7Sv6NuOfaXLtb3RgBqv/NbPxN5Dz2tzjVds4HrlhdYC
30PEBjErwdkW7kVMZE58l3SVfgi9xbkYeFEPgNnkgYipxBhx9lab4uK284O9
0j5C46XZd2GvHAvYYzw39XP6l/3Y3tPGOll4ndSknTWqT6npdWrOhRE7iCGG
5YygOBdDDsj7qhdAr37oZs2zt3Cj3EqM0ZYem7bzA5+MvcTPVr5N543evmkd
kd+KS3EnX17bPObhK7Y+rA2xAd9T0w8Qc2Hsn/R+s3266Ovoh5gT4/x494gH
acyBOAfI3ken4PeI808G/Yl9KPhB7O69G/R1+eBYP8c4G/nLX/7yn9SJp7U4
onm/UdPxzHgq49zHNvG7d98ztCbUM80ObsYGrpWuHzPa1C6GMXeUX51zzjl1
/o13mQ7TnEUXMYazPOTQtCV9a2346I/D2+9///vLWmutVfWUQV+TDz2X16Hp
M2ueZ8ZnI041O6TLOvebgfum0Vpr1ldoWOEJiXME+Xmb+e2g4bnwD4pv4hyb
0JXDa2h+vb3Ju+f+hpHzxUOeW8xA1HvB9xsIXzBecEbKBz/4wcojg/54bmIa
58S8613vKh/4wAcqjw/6uny8MzgrfDLNfSdiMjGFuIzGM0wxaRMR45kDYYah
OWtNzyhPgX6M6HM3A7EtPws6Kr+rNUHDN6O1mVvTnvXWmeug1jfMuaN3lnam
r9CnyePNvo33ve99let5p9rw8dzw1Z/92Z/VujTf8qCvKeYM0nxpVuLS5s+z
uW/iEe9XW2aOjTZi9qK1jwPoMc11JH+3L4mzxIHOBmtLjSxqseIa2qS6ZXPO
Ox5zf3wBw+6TFxfx8ahP4Pump1yeKI6iUYqz6IB6Owf9MZtHT7rYzvOzDuWD
g74uH7PV5Gl0yZjrFz/TmANv3+Thj3POhs1PaX2ZXa2nW1y3+eab15wq1r+f
hzkk5iuJucxwbFsvkxiC5hizlbz7cR5W4v+8f55h1Dh7Y+VBos31i9h7XJt3
n07Z9KDGTB5rxrXHXIRhgtkw/Mg4kP7oPMDmbEbvUa9vrC21sUB4jc1WMkMu
vFHDqDNMKcIjJd/wjsczbEudus38ADHXT9wsh6XVN89Djn5Os8nkI/LbYYlT
wzvDUx4zsppzTe3BfGP8uXILNcK29jLFvC996fQucU6Xz7UeLYTPLZ4h31ib
6jdt54fwVtt7/Pxirl9zJo95puYyWkNmCVx22WUDvuq3D/dnNq16n/vWs0BX
CN+A+9ZDHL4x85V4jNqiS/YiZrTyAdHe+CjFQtOqRx56+8DNu6CptUU7grbz
A8jPeAP5gORnfEDR5wJRWzZPyuwUOn+XziAZCXR99Vz7Cn/kgQceOFFswI9M
p6RlRX9w2+OmOJMyertpXV2Z8z7aCM+D5+b5+agDt61+0wV+iJk7rk0OEX3B
Mec4zr3m47DX8qA0z2brGsQAYqLtt9++5qTrrbdejQ3ifqIWZr/xdX/OPtT2
fL53bpxajD7UYeizmFLQ0T1Tz9C64ylv44yYLvAD2Hv4HdTHRvIBxSxk+YWv
m13WnDvSJURswFOu1myOSLOXST1TPBEzYmgQXanbREztfRND4L5h05Qnh+aM
OfUc2pr9rm26MnSFH8Jrp8fPuuGPEJvFnPc4D0O905oSd5th1sZ7mRTERPyg
+v3kUrz4zTN/5Frqz/QIsQNdpi21sDcLz0x857yfyJ2G3f/ahBzCM2z2zbR1
Rm1X+AGaeg6dgTdKnB2IeqczmGjkZpd14QySJnAcX7nYm/ZAg4i5Y/Yd3gZ1
DPVMtQBabeRZXUHz3Bt+vBVXXLFVnq6piZhxr+8WN8TMh7bmwl3iB4h6UOw9
fIPi7YB6p3O06OPWmHpn22by9IN9Re07Zp/zNTR12JhxL6dQ61UL4K3uIuRD
6kz6EHhk5YNd15TfDOjOcQ4f37L11uYzf7rGD+En4auUu+n7s/c0Z/LQeaJm
FPXOtu9NngMu4AsQG/FD2lciJ7W/0Fto/jEHw9yRtt9XP8S517xfYiH5IF5v
iy9oaqB5jq93Uw7Z9jN/usYPEF4be4+1Yq5fU4uM/BZ3iDF4Ttq+N/XGBnKM
pn8oZk7ymVtL+jG6MHNyUoizeeWDtEqzldqo4Y8GYjav2TC8sIsttljt5277
WusiP8RMEf0scojw2sReG/VOMQZ+UO90VlNb8/TwOtlX8J0aDV0lYqLm+fDy
jjijt837zptBzI6hI+uxMcPCOaNtf//eCuIZmjtunek77kJ9rYv8AOG1sffQ
+Z2LTOcPRH4b516LMdrqxeGTUcMUG8TsxYgNwke533771biC7qJ/e1g8AzFb
Sf+t3gzPSx2769zXhP3KM3QGhv3KM9Sv1tb9qomu8kPMNNXT2TxLq+kTEJ9H
vdOf0afRNn8anou+/zjPwpyQWB9ypXPPPbfmSnQJmn9ba2FvFZ4JDck9io/4
X9us2U0pPEO9yM7AoLWYV93WPpledJUfIHovaN94Wfx9xRVXTDQzXX6rr5Me
pN6pV7ote1N4nQ466KDqJ1TnExs0Z5eKQd2fdaMHXz/+sGl47hPn0YnUpdV1
5YNt7SWZEsRZo+ZSewf1cNPOunJvXeYH6O29oDmI5QJ6EmgTdD9xhHpnW/am
0FHtK67dvtJ77WZamGnMK0nrjzPahg048corr6zzscwDMuu6+bPoKsSz5lHT
yOwBZje2vU+mia7zQ8wWEJNaQ729F75+3333Vf3BHiy/pUsMmr/jPG7XJeYU
G5hFHTmpGIGeIuahWZpxIRbqaj1zcgh/LH2fzsIjK3fsQo7eD3JHz4w2Zm15
hs3ZWV1A1/kBQouUX1hLvA/NOlnTd6R/C5cMOocPH5fYgG5vX4m+/9BOaPl8
5GZbmPEVXvJhBS7AidaTeqfZxG2atTsliH52+pfnS/9Sp+lKn0xgGPghZs3F
elJbbvZeNPNbMYZcRE4yqH6YiA3U+2mS1oFaTMQ0rpvOIKYQ8zg3gQ7RFt1k
aiFmkuNCz5C/EG+2TVN+M4hnGP2C6jNNL2xXMAz8AKFFWnNiiJg11zyjSX5r
joo1R/Mb1DxbPhnz+9X8rQNep5jHGN4N88bEOjR99Ys29vZNDcgL5YN6TPiu
zc6iOXeJG2OWvThV7mg/kvN2UVceFn6I2QLNmJ2epwYaX7cu1UB5DMTsYoyx
3pvEl973Zi6kBhPvP55Qw6Cj0Cy74P0cbcQ8ID2q4iu6bb+Za/jUurM/jPUH
l43EW6GZq0fheD1CXe2TGRZ+gNh79DB4LlEPjLg9ZkHrmRZDRH/nWO1Nvo88
x/sidhYb2FfC6xS9I7R718drJ+Zpa2/f1EL4Y81HwKF6mcy46NWUcbufj1jL
+zuWH/GneU+95xlGjzGPq/VED+9a/NPEMPEDhBapb9b+2zsfQX6r3uSdC0/V
WPV3Rmwg3tRb1tt7Kv6JM9bUwuQgXek9HW3EjCzzY9Q7zdlsrsWmpqRH3PlO
Y/lxFoT4Ru7XhPdLXOoZ6rPwDLvcJzNs/BBeVjNH7NG8NvrBI3+Peie/ivyf
9jdWvms1CT3ZfNRiAzWXyEn9Si+hVTbnwgxrPXNyiPmM9mhcGWczR6wVWqa9
QC+DnpWx/Ig9PUu5YcC16anl+beWPMPm17uIYeMHCK8Nz3JzPmPA/VmLdMEL
L7xwzPwqYhszB8Us/LYRG0T9Rb+ZmMZ8Tb2cXdTtRxM4U31T35p6p1mNzVl0
uFOuLz70fMfyQ9tWvwx+jzOwDj300Fojo4GJU7uuKw8jP4QWGf3QcaZ8cxYd
fUncRwsbS/0Bd9FMXUtzZlzzDCxzYTyTruasowX3H/NU6MlyMppEG+P1eIZx
VgkNbNAem9HAMPIDWP+0SPNUxOsxT6Vtay7O3jVvTA8J3URM02Xf4Ggi5rHh
TL0Zfj76F9r0HF2juX/qLLghzsAatEd3NDCs/ADRe2E+MC1C/N6ms4mAP9/s
4uYZWHmu1MSwN/Oei694jWKeq3y/DR86iTmhyy+/fPWG67cblj6ZYeYH/M13
aG8Wm+qdsze7v0G/Uz7ee3582ry8Qn7dnAuT+D+Isegzcns1KXGW2WHO2WnD
h9Ys/7F+aJd8em2Kb94OhpkfoJkX8uOpa1qHg36nfLxLekK87/qRzIWZlua8
TwliHpCZje9973vLe97znlZ93ve+99WapmcY88aHAcPOD3EWiVoUXXnQ79FI
Hz93fpq77rpraPad0UZolc5AkuePtR9qUh/1MTmPvhHv2jBh2PkB7D3q0M7W
sQ4H/T41P66HLuJMnK719o01ov6jruidbctH3xVewF/Dxu/TAj+AOjW/gXNZ
Bv0+NT+uh5aV9YpEG4Ef1GZoZOpH6svDyA+JRGLKIDfn0Yt+Qh41ferqzfaz
YYuVEonE5GHdy8n5UvVDm4kgdviLv/iL6nXnZ+fvEPdmrS2RmHbA68V77Pxg
fcS8x84d4M0xA8s8C/1yPEVmqasp8QJPq31CicS0gOhloZOba8OvN9NMM9Xa
u7mZekn4VvUO8anpmeUVNR/LzFBzCXh6MudIJIYHURPSb+aMpphpKJ9wPjw+
cB4LTVIuYQYBD5++el4isYVZTDhEn4w6Tr+5OYlEohuIHkU+dd5w/erWOQ+h
/mHntek1xge9a93652eVg6jPO+MST/CHmcc+YcKE2oOY2kQi0T1Yt3qTzB8x
/8S6xgvWOc2B9qhXfXJzy+QTap9yD3NL5BtyErMRnSXIZ57aRCLRDUS90twh
PifzDXme5BPmdKlVqF32nu2KT9Qz/H4vZ4gt4t8071XvKv3SvxnahB4ofz9z
jkSifbAurW3r1BwU/WR0R3u99ewMAXN3zD9srmF84vfMaDUnj+Zg7tJIeYPf
U+90Rrl5oGodZvDpm6ZNmHcUMUnyRCIxeFiHfMPqleaVmYXS1Ar23nvvmmNY
180cIDRLcxj1m/FG6X92RqCZa5Oa0+9rNEpzOfWl6Hniq/L9zMzRP0PTSG0i
kRgcrD+9wGoNeECtQU3SejUX88wzz6zaZHOth2ZpZrI5yv4cP5R8wTkt/A7m
/U1OT2jyywknnFD7pc1okss4a1ZuIx+Rl6Q2kUiMHaw3/eVqkvQA87asTR9n
H8sv9An39lDgE/1J8gOzm+UHNEtxg7gDX5j7PCV9QpGfmOPW1CbkNnIc84b1
IOGozDkSiamHZr1SPcFsZp5HuYS5Voccckj1OoopejUGNQZr2OwyZy/Y583p
klc4I5k34u30ZOEe9U59HLQJs3TkHHId3GO+vHppahOJxOjCerKuaAjOHGt6
op0JwI9gPhINopnzRw5AswyNIbzT6pNmDtAlR3MWsDhB7nL22WeXcePG1djE
deKL0CbEMKlNJBJvH/Z+69fcZX4mnujwPZvHbK6p2RTNGfu9GoOz0mkM1qkZ
ZuYAW6fmtE6Nvdy/KRYxjyVqKeKV0Cb0j4tl5EipTSQSUw7rJvZ+5wfFTH16
gXmFPAe33XZb1f+aazw0BjUL5x/bt8UL8hBxvjNDaQxjcZ5jcJt+D7mPs0px
FG1CbqROon80+8gTiTeHqFfyETiP1Bn1/AXWlfN49FXxROOA5t7bqzFYi/or
ejWGXl/UWABniVWckyt2USeJ3MhMGufTmuc+rZ1Bm0hMCawPvgH+pOY6Mk/f
+WI80aHxBcIXxRNJY3BWsPnfYgY6JI0hfFGDhjjBLDVa5TbbbFN5L+ZJO0PX
fdNWU5tIJP6IyNf5DsxYlqOrVdr7zW1xFnDv3h9xhjmdfErWW/ii8IrzHkJj
aFOOP5I2Efcqb8Jnfg5dP7MwkRgt0BmuueaaOh/W3m+N65s4/PDDa32heU4j
RO+VPMO+qxeTj5ovisagdkBjmJQHctDAWWIF9Vj5EN1VPVSsJOe49tprB32J
iUQrYK3T6hZccMG6l+IJHiZ+gl6NgR5pf3WOEC9S+KJoDP4NcUaXZqTLlcRA
cqc4Q0oPuntpU9yTSAwKNAfnTFsXNEh9TiNpDHyI1o2cg69A7k5jwBVqBG3Q
GN4M3E9vvSLOoKRF8GiYY5M6RCLxR36gH3zyk5+sen7AHsoXpfeK30iMQXvk
jaYxmAfXpRmych73K2Zo+jXFRT/96U8r3yU/JBJ/xKT4QUzA46THgsYgxohe
CT7rLp2pguvoIubZmaGv3hkckPyQSIyMSfGDuFu+4dxpWv/48eOr9t/F82vU
JOiOvFHyoyOOOOKN+0h+SCRGxqT4IfoZ1Df0S/f2XnUJdFO+Tl7QOMcPL0Dy
QyIxMibFD010lRcCyQ+JxJTjzfJD15H8kEhMOZIfkh8SiX5Ifkh+SCT6Ifkh
+SGR6Ifkh+SHRKIfkh+SHxKJfkh+SH5IJPoh+SH5IZHoh+SH5IdEoh+SH5If
Eol+SH5Ifkgk+iH5IfkhkeiH5Ifkh0SiH5Ifkh8SiX5Ifkh+SCT6Ifkh+SGR
6Ifkh+SHRKIfkh+SHxKJfkh+SH5IJPoh+SH5IZHoh+SH5IdEoh+SH5IfEol+
SH5Ifkgk+iH5IfkhkeiHyfGDcyud59319ZL8kEhMOSbFD3jht7/9bbn99tvL
vffeW9dRV9dN8kMiMeWY3Pnd55xzTtlkk03q5wc/+EH51a9+VV555ZXOnbfn
mn/xi1/Uc4bnmmuucthhh5WXXnqpfi35IZEYGZPihxdffLHyw8orr1ymn376
stBCC5Vtt922nHfeeeXpp58ur7322gCvfMpgvT/00EPlkEMOKVtttVW54IIL
anwEyQ+JxMiYXH7xxBNPlLPPPrtsvfXWZd555y0zzzxzWW655co+++xT92Nn
esc6azteffXV8vDDD5c77rij3ncg+SGRGBnWifWAH5ZZZpnyox/9qK6jyB/8
av1YU8ccc0xZd911y+yzz14/a6yxRo3T6RNd1Sbc33PPPVfOOOOMynvJD4nE
H/H888+XE088sSy66KJ1zW+33XZVx8MbzbjAevF711xzTTnooIPK8ssvX2aY
YYYaU9Am/BsPPvjgRNzSZrjG119/veqvEyZMKNtss03lhgUWWKDei7pNIjGt
g253ww03lO23376uD5/VV1+9fOc736kxw8svvzzRXmpNPf744zV/32WXXcrC
Cy9ceQK/7LjjjuWiiy4qzzzzTP1zbYX7kRfdeOONVY/4zGc+U7lx7rnnrvzo
97vAcYnE1IZ1QIe0JsQFK6ywQq3/fexjHyubbrppOemkk6quh0diT/V3/P8H
HnignHbaaWXzzTeva2uWWWYpK664Ytl///1rnNE2bcL1y4PuueeeMn78+LL+
+uvX65511lnLSiutVDkxcqVEIvFHNOOC3XbbrSy22GJVi1x88cVrXKBm8eST
T04UF1hvuOW2224rRx99dFl77bXLbLPNVuaYY47630ceeWS58847awwyyHg9
+OyRRx4pZ511Vhk3blytxeBB97fHHnuUn/3sZzXXyLwikRgZ1hEfkbjg9NNP
L1tssUWZZ555alwgrhAXXHfdddUX0cw5xAjPPvtsufLKK+ufWXrppWvOQfP0
b/z4xz8ujz322JhrE6ExuLbLL7+87LXXXvXa3M98881X65yu7de//nW9tkQi
MXnYQ3GAuEAMwHMoLuArWmeddWo99O677/6TuIAf4tFHHy3nnntu2WGHHcr8
889fZppppvKJT3yi7L777uWSSy6pa3UstAn89cILL5RbbrmlHH744bXWQmOg
r3zuc58rxx57bLnrrrsyl0gk3iKsMVrjFVdcUeMC9T8xuXW/5ZZb1hiDn6C3
HioGue+++2odQG0Dr0SOT+Ogh1q7U6OGiK/4Iu+///6qnWy88ca1xuL700bo
kddff32taaYGmUi8fYgL5O7igp122qksuOCCZcYZZyxLLrlk1SouvfTSWvvs
1SZwwM0331w9EjyY/g6u4HH+3ve+V3s6cMlo5PzWOp4Sv/B4qcfQUOQSoTGo
Yz711FOpMSQSowzrTz5hTR9//PFlww03rGtd3rHKKqvUfqebbrppRG2CF1tu
If9fYoklKk/gGJ4D3ky66FvVJkJjiDiHr1OcI14IjYH3KTWGRGLqw96rbilH
UA/kHbAW1QnXW2+98v3vf7/mFuKCZs4R3uYzzzyz9nDQLuUqyy67bPna175W
9UMx/5TUQ0NjuPXWW2uMwrehdkJnoJnQSdRPUmNIJMYW1rFYXW6x995717hA
zULdUFygr8vXmz1ceII2QBfUC8p/EOsZz9AR9YdOLo7AUWIZdRYaw0YbbVQ1
BnzD13nggQeWq6++umqhqTEkEoNBxAVidzE8X4G4gG9CXPD1r3+9xvzigl5t
gq+bTigv0RcVNVSaZ7/6Rnw/tdLzzz+/fOUrX6nagu+3yCKLlJ133rn6N/SU
tcmXlUhMywhfolheDxdvlJwjvNqHHnpozQF4qZraIB7gubr44ovLAQccUPbc
c8+qU/TWNZo+hquuuqr+WbUIcYe4YbPNNqs+TvEEH1QikWgfoofLGhbjiwdo
kdawOuMpp5xSNYjmfJmICez5+rvEFb3/Js1TLwiP5lprrVV1Udyz5pprVo2B
Jxr3ZC6RSLQfTa/2rrvuWnu38IRcQH3U7/MyT8onJc6gceIMsYEYQU8IjUF9
4pvf/Gbt8cBHWa9MJLqF3h4uvV5zzjlnXd/iCvGFGohaSDOfaMYTF154YdUY
+Bj8PTVRvkyzXPBPzmhIJLqN8GrzOX/3u9+tPmdapHqoWTNmseinpF+odcSM
CRqDeVZ0DPmE/OTkk09+o3aaSCSGB+oJTa+2+oacwzwWHibahP6uo446quoK
Yg3csNpqq1VeoW/yOqTGkEgML6KHiwfaLBaagh4uuQPO4HlUr1xqqaXKvvvu
W2dc4pXUGBKJaQPh1ZZXHHfccWWDDTaoPu3pppuuxhOhMeCR9DEkEtMmwqtt
dpV+LZqDPIPGkD6GRCIBYgS+B14pWmZqDIlEIpFIJBKJRCKRSCQSiUQikUgk
Eoku4P8BJiQ4iQ==
"], {{0, 254.}, {264., 0}}, {0, 255},
ColorFunction->RGBColor,
ImageResolution->72],
BoxForm`ImageTag["Byte", ColorSpace -> "RGB", Interleaving -> True],
Selectable->False],
DefaultBaseStyle->"ImageGraphics",
ImageSize->{40.73046875, Computerized},
ImageSizeRaw->{264., 254.},
PlotRange->{{0, 264.}, {0, 254.}}]), !(*
GraphicsBox[
TagBox[RasterBox[CompressedData["
1:eJztnQm8jNX/x+vfoleWVCK7a8mSiCxRkjVl30WWm+6VfYuLyBoi+xKSJaFI
EYok+xLZl8h6o5CU9r3z8/6+Xsf/MWbuOnOfmbnf9+t1izFz53nOOZ9zvst5
zjfi2a4Nov/vhhtu6Hnblf80iIyp1KNHZN+GGa/8pXGXnu3bdYl67skuL0S1
i+rx8LM3XXlxxpWf2Cs/N1/5MYqiKIqiKIqiKIqiKIqiKIqiKIqiKIqiKIqi
KIqiKIqiKIqiKIqiKIqiKIqiKIqiKIqiKIqiKIqiKIrr/Pvvv+b33383ly5d
Mt9884356quvzJkzZ8yFCxfMjz/+aP766y+3L1EJMP/995/0M/1Nv589e1bG
wddffy3j4rfffpNxovgX2v2PP/4wsbGxZtGiRea5554zDz30kMmePbvJnz+/
qV69uhk2bJjZsmWLuXz5srxfCT/Q1g8//CD9TH/XqFFD+j9XrlwyHqKiosyC
BQvM6dOnzZ9//un25YYN6OmXX34xmzZtMpGRkeaee+4xd955p7T7fffdZ/Ll
y2fuvfdekzFjRlOsWDHz6quvmnPnzqkOw4x//vlHbJ4pU6aY4sWLm7Rp05qs
WbNK/zMOcufObe666y4ZC08//bTZuHGjzNtK8sG2QH9NmzY1mTJlMpUqVTIT
JkwwR44cEZsE+2P16tWmbdu2okvmxcGDB5uLFy+6femKn2D9w+YcM2aMKVCg
gMmbN69p166d+fTTT2VdZBwwHkaPHm0efvhhGSd16tQRHapdmjyY+06ePGli
YmJkfmvZsqXZu3fvdWsc78MnGDVqlGiQfli4cKG8roQ++H6LFy82jz76qKyB
06ZNM7/++ut17+O1NWvWmNq1a5ucOXOarl27yrhQkg426NKlS03FihVN6dKl
xdb3BXo7deqU6du3r9go0dHR4j8qoY1zHs6RI4fp3Lmz2KS++Omnn8ySJUtk
zJQpU8bMnz9f/ZJk8N1335mxY8eaPHnyiK2Jrx0XtD/rX9myZU21atXERlVC
G+Lg69evN40aNTIlS5Y0c+fOjfP9aPbo0aOi1WzZspkBAwbIXK4kHux47Ih+
/fqJHco8iMbigv7asGGDadiwYYL6Swl+fv75Z1nXiAMkdF4lFjBy5EixR9u3
bx/nuqn4Bj97//79YlOyDuJvB+IzSnBDzOX111+XmHezZs3M7t27E/wZfEdi
eQn5jHI9qkEFnBpMqJ6S8hnlev7++29z6NAhsSXI/YwYMSLeOCd52V27dpk2
bdpI3mjcuHEpdLVKoEBPs2bNMiVKlBCfcMeOHfF+5vvvvzdTp041hQsXNi1a
tJB5WUk8xLLOnz9vhg4dKnHOLl26mG+//TbOz+B7f/DBB6ZKlSqmfPnyEs9W
Qhv6dOXKlebJJ580FSpUMO+9916ccU7+jVwi8XHyhD169JDYnpI0yAvNmTNH
7PqaNWtKfMzXWmg1yz4Z1sAmTZqoDRIG4F+QE2YfGv3KHrW4YnPkCNetW2fq
168v+2fYz4FNpSQNbMvPP/9c9qjh3/Xs2VPyE546RH/o9aOPPjK1atUyERER
YrsSJ1VCH/ZCkZcvVKiQqVy5suSM6Vvnemj3ch87dswMHDhQ9moQH9+2bZuL
Vx4esAebPGupUqVknxI2xuHDh6VfiFujPWwPbFDanJwQ+wU/++wzty9d8RNo
68CBA6Zjx44mS5YsYpcuW7ZM7B76n3GAvblv3z5ZJ1n/7r//fjNx4kSdh/0A
eULamr26tGvmzJll/wN2/muvvSb70/C7sVPoH3S4du1a3RsRZqAl9g3T1/h5
7BklV0HsmzWyd+/eskeR8fHAAw+YV155Rf1AP4KeiHVhg9SrV09yrzw/wbMS
PENBDp+42QsvvKAxsDCG9fDgwYOmf//+pmjRotLvPCvBGECX+CDs1WavVHz7
OZSkwZqIbYqPOHPmTDNkyBCZB999913ZK6p7tMMf+ywp/c2cTAzu5Zdflnwg
/oc+P6ooiqIoiqIo4YsvW5/X1Q9IHcTV1zoOAgfxFvYO8jwTMVLbztZHZx8b
Z2vps2LhDfs2yDmQr3Lm/ojX2VwxuWM9w8K/oDOeCZs8ebKcZ8BzvfbcLLtP
u3v37rKnl70ySnjCnjPOjeG8oGefffaaPTB2bzd7hcnTM08r/gMNssaRF7r7
7rtNr1695Kwn4P/sD2zQoIGcbzdv3jyXr1YJFMy3PDfB2ZZVq1Y1H3744dV/
s8/tct4F+2k4f1bxH6pBBVSD7qEaVEA16B6qQQVUg+6hGlRANegeqkEFVIPu
oRpUQDXoHqpBBVSD7qEaVEA16B6qQQVUg+6hGlRANegeqkEFVIPuoRpUQDXo
HqpBBVSD7qEaVEA16B6qQQVUg+6hGlRANegeqkEFVIPuoRpUQDXoHr40yOup
XYOp6Rwxbxq0968aDCyeGqQGGmf48HPu3DmzZs0aqTeXmjTIOXOcIcfYo7ZC
ajjn36lBzm6i1hZnqXF+E+epUe9ONRgYnBqkzgtnaq1atUrOVxs+fLjUeaQe
VmrQIGf2ob0vv/xSasK9+OKLcp4YdfeofxnOa6LVYNu2bU25cuWkthK1t1j/
Fi1aJPYRte9Ug/6HcXfmzBnTr18/c/PNN0u9HWrU33TTTSZNmjRSe4f5r2TJ
klK3NxzPlkRbnKdJO7z//vtS94vaU7feequ0B+c6UieauYrzVsNRi9z/1q1b
pb4ktZaoc3bLLbfIGODPjAHapH379tJO4dgGboCNRS2d7du3iw1y4403Xm3z
IkWKSE1C+oPXChYsKGdLcg5wuIxDW1+WM4zxezlHlRqzadOmldrEzDvURr3j
jjukBiNrADXDOeeWz4VDGzCnor+TJ09KvS3WQOZi+p3avNQbZDwwBmiHpk2b
ytmjqcVGDxTW5jp69Ki0O7Ym6x115h577DGpeUbdVepd4R9Se5X2z549u9gq
jNcLFy6E9Di08w9nGGN3YWvffvvtUn+RGNTbb78t8w01afk760CGDBnMgw8+
KHPR7t27xV8K1XFo5x/68ZNPPjEdOnSQe0yXLp0pXLiw6dSpk9m8ebM5dOiQ
GTdunKlQoYKMD2IGxGwYN8ePHw97G93foD1inbGxsWJbNWnSRLTFj63zSf1B
51n3jNPVq1ebZ555Rvooffr0Mj/iPzIOid2E0jikDRg3+HizZ8+W8cS4w86q
VKmSmTRpksSiLNwbMYkZM2aYihUryvtor8cffzwkxyHXyZnaxFp27twpdSax
d5h/WPtZ56g56ayzi92zZ88eqZVevHjxq7VhGzduLLY7tqlnDXvlWmzdCHxp
4i1RUVEma9asV/XE3zds2CDzojdszWxiMk888YTYJqwJ1EemjjYxDOqWB7Ov
aH0+1jbGTfPmza/WG2YNJP5y+PBhn5+nbTgLnjFbrFgxGYd8njWStTIUfEX6
h3764osvJN5CbQPsbsZCjRo1pNYn/ewL5potW7aIT2htdOI0rVq1knmazwZ7
G6Q01t4gxr5x40apK46dYf0dYg/Lly9PcG1jfhd6w1ZFf9gl2Cc1a9YU2y0Y
50OnzbV27Vrx6RhzrH3MP+3atZO28Zx/bG7M816wI4hdYLvhOzIXYR9go/P7
8S2DzUa38w/2zzvvvCO5JuYQ/I/y5ctLrV38koTMofwubB9qj7Rs2VJsd7RI
vKBHjx7SluHkLycV7t36O3v37pU8A5rB3mDeeuqpp8SOYu5ObDvxfuZD6yti
x7CW0BfkNfAtsGOwd9zsA2tzMV6wr1m/mH/QHvMPsc7FixdLG3nCWORz1ITG
LvWcV/gz44z1D3vMjkN+PzY6dlsw2OjOmBPzA/MG/Y/9Q835Ll26SDzOl/0T
F9ZGnzt3rqlVq5bMa7RB6dKlxb9m3IWyv5wcuGfsDea1N954Q/KtjDvWK2wP
cn6sZcnFOR/iKzIOWROIow0dOlRiOm71gW0DbMdp06ZJPIFxxzgh/oRvx/jx
Bde9cOFCWd+JTRCD8jav8D2s/eRs+L3Y6KwvxBbxK/EVuQ435iI7B+Ozk18n
lmTtnxYtWoj9423+SSy0Cb41tetZUxlnzMn4ztOnT3e1DVIaG285ffq0zO8N
GzaU8UB7EGMnx8rc5O+2sOOQdRW9Mw75TuKrjHX6gBhsSvSBbQPWL9sG2FvY
zNgBrIX4QvFdC2OTeA22KvMKcQjmroMHD3qdV1hH+L2MdfTH9+Er1q5dW2x0
9G73/wUaG3NinmUOrly5ssw/WbJkkfgTNe7imn+SCjn+/fv3i1+Nv2zj7KyR
zGcp2QZJIaHX5Wv/Iu2Oz8ceP/wS1iQbb3n++eclxoyvHEgYh8Q0iNtjj9AH
6BHfgxgs8aBA+evOmBNtQK4zV65coh9rcyWmDdAYsRvmcWKl6In5jD8zrsml
eYuFMsaw7bp16yb5VWujt27dWq6LmAVjNVBtYPcZ0N74+vQB101/vPTSS5Jn
CKQGrJ9C/hD7gbiNsw2wmbAn4qrzm9Dv8dd92PwoNl1ccwSv03fMwazrrP9O
iKksWLBA5h/sjbx580rcb8mSJeK3pBS2D4id0Qf46fQB+26IpRF7Za7wl69o
fT7uke/EF8M/dbYBMdCk2lxolrl90KBBYkswprFnyeksXbrUayyUPuV6VqxY
ITYfth9zAb5iTEyMxHPIC/izDazPx/4B9M/8Y+dg2n3Tpk3X1NUNNHZNwF/G
T6ENbP4L28jzWuwcyvjGZvLlv9h7RQOMeVurNjkwXukT7AN8Dl+/k9exddjD
yJjytCXQMHFl7pG1n/nbzT199AHzHX3AfEzcEC2yJjGe8RW55uTkMugn+uHA
gQPie9k4u405+asN6He+h/mDmIbdr4DGO3fuLHFA7pXr8fQV6SdsWnxFrsvm
c8h5Y9cmJ5/jjLtZn485GO0x55HnS+k52BNnG9SpU0f6iJg69+0ETeIn4Vev
XLlS9OsN5i1iu8x/aAF/P7kwd+GjYC8wf/nKEdh1rkyZMuJjYFc5oR/pC/wg
X9fvBrbNmB+qV68utilrCTESYiVcb2J9RafPh59Rt25daT98MGICjEVsRX/D
99JfjGtiquwZQovWV8QOp588NUUbcD3EpsuWLSvXSRugS64f/z2xfpJzbzl+
ODYy10LevFq1ajKn0+7BAlpk7afPnLl/C/9GvhIbBtuBedUbrFk8x0OfowXa
L7n4S4PBDus48z73yj0wBokR4CuyJ4P4f3x+ktPnw69gX4FdW5j/2evp3OMT
KNAUY4kxQ7yDuAP3wxzz5ptv+tQU98dcjz1qfUWunxwb+yYS4ita3wVfFZ+P
tY7vZ/zQrgMGDJDxG8x7JbyhGkwZGFvM3Vw7eXLrK0ZERJiuXbuKTe7NpnPu
M8CvIe6Gn0O+hRw5ezTQJP2TkjAfoCmeN7H7t1gb8X98xV+sXUsOtU2bNmLP
sn5xP8St42sDm+ejvfgs8w96xkbGF0xJn8+fqAZTFusr4tdi07EWoEV8WWf8
n/cxFvkz/iP5J96Dz8dYpx3wH2hDt0AbXB+6IB5tNYXPiKaIkeKPefMVWfvp
U+7D5rcT0gbsq8PnI9ZI7oV9L276fP4gmDSIT0e7e/7wOj5oOGjQgk134sQJ
iafY+D++EvYd8X/yvvhY7MNgLyM65T2PPPJIwHy+pGI1xZioV6+eaIo+LVWq
lOiGeJrVlBPagPwpviL35WwD/Dz8PdsG+I+0AT417cVnaINgzbclBqcGiWUz
33jTAXbUxx9/HBANMgdGRkbKd9Mnnj+8Pn78eNnrEC4atFg/CRvTxv8ZZ8TQ
8LHwGxnPzP/s2ycG6JmbCRaspugrnqtAU/hrxEmIDeIressr2jYgt+JsA3TJ
Z4m12Dbo06ePPG8VrG2QFKwGyd+gL2x5bzrAPsDnpk38rUGeVyanQ7+xl8Hz
h9eJ69Mv4aZBsDYd+Zno6Gh5XpZnRm+77Tbx+ci5M/8xD4YC+GXEh4i/YF+i
H/Iz+IrkDb09exlfGxCDCqU2SAxWg+QRmW/I33jTAes/cxT+i781yLkRzH34
5vjYnj+8jg/Ee8JRgxbsDfLeEydOlPsmboPdGUz5loRiNUX8hb3saApbkrme
9RyNMvY8fUVnG2Cb4VuGahskFKtB8po29+pLB7wHez0QtihxMuwR/CDPH14n
rxuOtqgn2GrEOfF/sMWIwTthvFr/IBR8IWf8xT5fwLrIXI/Nap+9dN6LbQP2
GtAG5CTDGactSi6fPL03HRCrwTcOhC2amuKi8RGXBm18Ct+AeI7nfotgxu7r
5rkefF38RPxFdMn+cvYNWVKrBoMhLqoajFuD+ELMkYxb8vuh2A7k73n2kudd
ec4L/wc/x3mfqkHVoJvEpUHWPfbV8FwUMVP6IxTB7mTccZ/k29njw75Ti2pQ
NegmqUGD8aEaTHkNEu9kLoxLg3wfe35Vg6rBcMNqkPwb+RtfGsSOJ87MPgi0
4A8NEm9mHwXxZ/KzvmIMvM5Y5EwzrhF/IlxRDaY+DRKPYg8Dz9PwvCOxK2+g
QZ4hY48we6c8Y+ZJgRgDfgDPVHE2XFzPDzI3sIfLnj0brqgGU58G7Z4G1kL2
EbOHwRv2OTD2yKIF9s0o/kc1mPo0qAQXqkHVoOIuqkHVoOIuqkHVoOIuqkHV
oOIuqkHVoOIuqkHVoOIuqkHVoOIuqkHVoOIuqsHrNcg9K0pKoRpUDSruohpU
DSruohpUDSruohpUDSruohpUDSruohpUDSruohpUDSruohpUDSruohpUDSru
ohpUDSruohpUDSrukto0yJnbnrVrVIOKm6QWDaI7atpzvi21wZ3nWqoGFTeJ
T4M8x0NNVM54DUUNoj3OyUR3nNU8bdo0OVeTGmgW1aDiJnFpkH/jLOSmTZvK
eePbtm1z8UoTD7UIqVvAec1Tp06VuvPUGqHuEmfbWlSDipvEpUFbTxMdUrPc
V32OYIO6iZzTfurUKbNo0SKZQ6glS/1Bznen3gG1dy2qQcVNPDXI+AuFerve
sD4f8wa1Sqg5SG0R6i4XK1ZM6p5t3bpV3uPE1ll0toGipBRocNWqVTL+qP09
adIkqT9AHdtQ0aL1+S5dumR27NhhRo4caUqXLm3Spk0rtdap77V06dLr1nE+
R2yGeiIzZ84U/VGzV8+yUFIS6n9QB6dRo0ayXpQsWdIMHz7c7N69W+rzYI8G
sxa5PmJH1A6iLgm1sjJkyGCyZcsmf548ebLYnc57sJolRkrtk1GjRkm9enxF
ag6HYuxJCV3wnVj35s6dK7GKrFmzSn3GatWqmVmzZpkjR46Ircb7ggnr88XG
xsoaFxkZaXLlyiXXTr3KgQMHSp0gtObEapb74v7QHHMPNbK5Z+KmxFAVJSVh
XWA93L9/v4xd1kLiF+ixefPmZtmyZTLW8aPcXhP5fuxk5o1169aZPn36SD3Z
9OnTm8KFC5u2bduKbc39OPHUbJs2bUR3aLZUqVKmb9++Zt++ffK7FcUtGN/4
TNR97NChg8QzsM/y5csn8Qxs1vPnz7viK1r7EfsYO3ns2LGmfPnyJl26dCZ3
7tymQYMGZt68eeITen4On4/rRrO9e/eW+0KzRYoUMdHR0RK/wS9WlGCBNYO6
4cQmmjRpImMcLbI+jhgxwuzdu9dcvnxZ7LqUuh7s4WPHjonO6tevbzJnziw/
7B8YM2aMrG/efD6rWXw+bFS0FxERYRo3biy1nbE73V7bFcUXrHcnTpwwU6ZM
MVWrVhXbLVOmTJJHQwvsNWH9CJSvyO/Fpjx79qzkTzp27Cj6yZgxoylRooTk
Hsg1ePP50CzXZzWLzWl9vvHjx0t92WDzcRXFG6wR+FG7du0y/fr1M8WLF5d8
d/bs2U3r1q0lr3bmzBmx9/y1ntg17OLFi2bz5s1m0KBBsgajvYIFC8r34qOi
MydWs1zP8uXLTVRUlMmZM6d8js/36tXL7Ny5U30+JSRBF9ifxO2Je+TPn1/s
00KFCpmYmBizZcsWsV+T6yva/WXENNlfVqVKFVnDcuTIYWrWrCl5PL7H89r4
Xl7HZx0wYMDVOA3XR8yUuYJ4qKKEOqw1xDfwperVqyf5ALRYtmxZ8cuILSYl
r2jjltiIixcvlrw6OT7is+TOhwwZYg4dOnTNZ5w+3549e8y4cePkveQH8+TJ
IzbonDlzJIaqKOEGtif+Fr6VzStmyZJFfEXGPfGThOYV0StrGGts9+7dxd5E
1+wv69Spk8RpPe1HG6fhGsht1q1bV3xVfD72Zo8ePVr+TX0+JZxhHUIH+Fj4
iuTZWLfwwfDZVqxYIXtU4vMVsRHx74hx4ruxv6xZs2ay1uITen4neUriNPx+
cgt8H/Yq+9Pw+XhGyfl8oKKEO+gCe5DnK/AVCxQoIOtY0aJFxTfbvn27aAm7
0ZsW8TNZO8uVKyf7yyZMmCA2qed3sBbye/A9Bw8eLPtbsTtZN/lenu3gdylK
agWbkvUJPbEHjDgK6xP7oCdOnCjP8aERT/uQNQvblf0txGK8/V4+xz4e9n9W
rFhR9pex/tWuXdvMmDHjmmeRFCW1g6YOHz4seXHOwcBH4wef7a233pKcY0Ly
ivw77zt+/LiZP3++5NWxdcnNo8Nhw4bJ96jPpyjXY31Fcug9e/YUu5GYCfFK
fDjWPNYub7kMp89Hbp64jN2rQ26+W7duYo967glVFOV6WKPYD0b8hDgNe0/J
8eMr9u/fX573Y4+n9RXt2S/4kOTmiY0Sp2GPZ6tWrWS/teeeUEVR4gdt8azs
7NmzxSbFV2RdJK/BGUvk/sg78v/p06fLnjK0x/vq1KkjPh97QhVFSR74isRd
hg4dKnFQfDt8RfL9+HecHcVr+H08F2GfA1SfT1H8BzYnOcFNmzaZzp07y74y
1rw0adJIHNXm5tevX3/dnlBFUfwHOQf2kXHOIHs6yWHgM3IWmueeUEVRAgda
JM5CzkK1pyiKoiiKoiiKoiiKoiiKoiiKoiiKoiiK8v/8DyvCCzs=
"], {{0, 154.}, {
           225., 0}}, {0, 255},
ColorFunction->RGBColor,
ImageResolution->72],
BoxForm`ImageTag["Byte", ColorSpace -> "RGB", Interleaving -> True],
Selectable->False],
DefaultBaseStyle->"ImageGraphics",
ImageSizeRaw->{225., 154.},
PlotRange->{{0, 225.}, {0, 154.}}]), !(*
GraphicsBox[
TagBox[RasterBox[CompressedData["
1:eJzt3Qm8z2X6//FZ/vObJVmzbxHZ4siu7FkqQkKiLKeyRLZIZQlpISqiRWWp
VKijVBJZQrYip5SQfd/DMTXTzFy/ed/zuM3356+ZzjfH59zH6/l4nBlLuM/n
nM/9uT/Xfd3XVSSxV4vOv/nVr351zx/++T8tOg2o27dvp/tvyvrPn7TqeU+3
Lj3vvOO6nv3u7HJn32qJv/3nL7b79a9+1f+fH//vnz82AAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAA4Bz4xz/+4T4AAGH78ccfbefOnbZq1So7dOhQ1MMBAMTp
73//u+3atcvGjBljdevWtaeeesq+//77qIcFAIiD5vR9+/bZiBEjLEuWLFa/
fn376KOPoh4WACBOf/7zn23evHluPs+TJ4/179/fjh07FvWwAABx8Gt1xV8K
FSpkVapUsenTp7NnCgCB+stf/mKrV6+2Nm3aWLZs2axDhw62efPmqIcFAIiD
1uRHjx61KVOmWOnSpa1kyZI2fvx4lxMDAAiP5u+vv/7a7rrrLrdf2rx5c7d2
BwCER2v1EydO2KxZs6x69epWuHBhGz58uNtDBQCER/ulO3bssGHDhlnu3Lmt
Tp06NmfOHPZLASBQOnO0aNEia9y4seXKlct69Ohhu3fvjnpYAIA4aK1+4MAB
e/rpp61IkSJWvnx5mzp1Kmt1AAjUX//6V1uzZo3deuutLrexXbt2bv8UABAe
rcl1lnTatGmWkJBgxYsXt1GjRllKSkrUQwMAxOFvf/ubO3fUr18/u+SSS+za
a6+1xYsXRz0sAECcTp065fJeateubfnz57cBAwZQjxcAAqX9UuW8PProo5Yv
Xz676qqrLCkpif1SAAjUDz/8YCtWrLBWrVq53MYuXbrY9u3box4WACAOvhbM
iy++6PZKy5Yta88995yr+wUACI9qwaxfv96t0bNnz2433XSTy3UEAIRHa/Xj
x4/bjBkzrGLFiu4s0sMPP2wnT56MemgAgDgot3Hr1q32wAMPWM6cOa1Bgwb0
uQOAgKlG44IFC+y6666zvHnzutx11REAAITH14IZO3asFSxY0CpXruzOmmoN
DwAIj2rBfPbZZ9a2bVu3X9q+fXvbuHFj1MMCAMTB14JRnzv1uNPHuHHjXI1e
AEB4lNu4YcMGV1tddRubNWtmK1eujHpYAIA4aK2uPMbZs2dbjRo1XJ+7oUOH
unxHAEB4fC0Y5amrz53qfL333nvUggGAQKkWzNKlS61p06auHm+3bt3ocwcA
gdKaXLV3J0yY4OIv6nOnvVPF2wEA4VFu47p166xjx46WNWtWl+Oo2jAAgPD4
WjCvv/6663OnWjCPPPKIO3MKAAiPrwWjPkhaq6t2wCeffBL1sAAAcdJaXTXW
1Q9JtRvfeOONqIcEAIiD9kS//vpr6969u6sXcOONN1pycnLUwwIAxEFr9KlT
p1qxYsWsXLlyNnHiRGoFAECA1MNu+fLl1qJFC5ejnpiYaNu2bYt6WACAVFLO
i2rvjhkzxtVTr1atmr355pvkpwNAgBRfmTdvntWpU8fN6ffcc487gwQACIvy
F7ds2WL333+/5ciRw+rXr2+LFy+m3gsABEh1GRVnUT2Ayy+/3EaPHm0pKSlR
DwsAkEqqB7B27Vrr0KGDy11s3bo19QAAIEC+z9ELL7xwum7XSy+95Go0AgDC
orl7yZIldsMNN1iuXLmsa9eutmvXrqiHBQBIJfXB2LNnjz366KNuPlePI/U6
0n4pACAsqrU4Z84cN5cXKlTIhgwZ4uIwAICw+Jou6iutfdHrr7/eVqxYEfWw
AABxOHHihL322mtWunRpK1mypI0dO5Ya6QAQIOUufvrpp66HkWq6tGvXzjZu
3Bj1sAAAqaTcxcOHD9v48eOtQIECrjb6K6+84uZ5AEBYlLuoM//qXaSaLn37
9nV1uwAAYfE1XR544AEXc6ldu7bNnTuXmi4AEKBTp07ZO++8Y5UrV3a9ox96
6CHX/wIAEBblLn755ZfWpUsXV3exWbNmtmbNmqiHBQBIJcVWjhw54mq6XHbZ
ZS5/ccKECfSjA4AAqR+dzhO1atXKcubMaXfeeSc1XQAgQKrpsnv3bnvkkUcs
T548VqVKFZs5c6b7dQBAWBRfmT9/vtWrV8/y589vAwYMcHEYAEBYlLu4efNm
69+/v4u5qKbL8uXLyV0EgACppsvrr79uZcqUsaJFi9rIkSOp6QIAAdJZ/3Xr
1lliYqLLXVRtF2q6AEB4FFs5ePCgq+mifnTlypVz/eiUow4ACItyF5ctW+bO
FSmO3q1bN9u3b1/UwwIApJJyFHfu3GnDhw93uYvUdAGAcGkPVD1FVdNFtXQH
Dhzo9koBAGHxa/TBgwdb1qxZXT3dVatWRT0sAEAcNKcrbq56i5kyZbKaNWu6
HtIAgDAp9qJzow0aNHDx9H79+tmxY8eiHhYAIA5aq+/fv9+eeOIJK1iwoFWq
VMmdO2KPFADCpFzG1atXu3NG2bJlsw4dOrgaAQCA8GhNrnjL1KlTXa30EiVK
2Lhx4zhzBACB0vy9YcMG6969u2XOnNmdP9LaHQAQHq3VT5486fqPXn311Vao
UCEbNmwYNbwAIFBn5qvrTOn7778f9bAAAHFST4xFixa580e5c+e23r172+HD
h6MeFgAgDlqrq0ajekoXKVLEKlSoYK+88gq5jQAQKNVSX7Nmjd12220uBtOu
XTu3fwoACI/W5N99951NmzbNEhISrFixYu5MknrbAQDCo/l706ZNLp6eJUsW
F19funRp1MMCAMQpJSXF5b3UqlXL8ufPb4MGDXL5jgCA8Gi/dNeuXa5fRvbs
2V3e+ttvvx31sAAAcVJu45IlS+yGG25wfe169Ojhan4BAMKj/VLlp0+cONGK
Fy/u+k9PmjSJ3EYACJRyG5OTky0xMdHlNrZq1crWrVsX9bAAAHHQmvz48eM2
Y8YMq1ixojuL9Nhjj7m5HgAQHuU2fvvtt9a/f3+3VldfpAULFkQ9LABAnE6d
OmVz5861evXqWd68ee2+++5z63cAQHiU27h3714bOXKkq+9VrVo1e/PNN9kv
BYBA/fDDD/bJJ59YixYtLEeOHNa5c2eXww4ACI/W5EePHrXJkydbyZIlrUyZ
Mvb888+7NTwAIDzqc7d+/Xrr0qWL2y9t3rw5fe4AIFBaq584ccKSkpKsatWq
VrhwYRsxYoT95S9/iXpoAIA4KLdx27ZtNnDgQBdXVy7Mhx9+GPWwAABxUv/p
+fPnW8OGDV0eTN++fe3IkSNRDwsAEAfti6qe15gxYyxfvnxWuXJle/3118lt
BIBAKYau/dE2bdpYtmzZrFOnTrZly5aohwUAiIPW5MeOHbOXX37Z5TUqv3H8
+PEuNwYAEB7N3+pBfffdd7vcRtVaX758edTDAgDEwfek1jkk1WxUjXX9GAAQ
Ht+PWnkv6nHXuHFjW7FiRdTDAgDEQX2np0+fbmXLlrVixYrZ448/7vIcAQBh
UV8M9TxSvssll1xit956q23evDnqYQEAUklx9IMHD9rYsWMtf/78lpCQ4OLo
5LwAQHhUd3fp0qUuz0Vr9O7du9uBAweiHhYAIJV0hnTHjh02dOhQy5kzp9Ws
WdPef/99zpACQIBSUlJcXcYKFSq4uItqealWIwAgLIqXf/PNN9azZ09XD+DG
G290+6QAgLD480WTJk1y54tKlChhTz31FLXTASBAyl387LPPrG3btm6N3rFj
R9u+fXvUwwIApJLW6MpreeKJJyxv3rxWqVIlV1tX50gBAGH5/vvvXS+jOnXq
WK5cuaxXr1526NChqIcFAEglrcUVYxk0aJCr6dKoUSNbtmwZuYsAECBf0+WK
K66wQoUK2fDhw6npAgABUu7iV199ZV27dnX10Vu2bOl+DgAIi2IrR48etYkT
J9qll15q5cuXdzVdlP8CAAiL8s4VN2/atKmLo99xxx22Z8+eqIcFAEgl1XTZ
t2+fjRw50tXo8jVdyF0EgPBoD1RzePXq1S1Pnjx27733ujOkAICwaC2+ZcsW
N4/rvOj1119vq1atIncRAAKkGovTpk2zUqVKna7pQu4iAITH13Rp166dZcmS
xW655Ra3ZgcAhEWxlcOHD9v48eMtX758VrlyZVfThX50ABAe9aNbtGiRNWzY
0OW6dOvWjX50ABAg5S7u3bvXHn74YcuRI4fVrVvX5s+f734dABCWU6dO2dtv
v+1q6OrMqGq60I8OAMLja7rcddddrqZLs2bNXD86chcBICy+H92UKVOsWLFi
rvbic88952LrAICwqKbLypUrrVWrVm6Nftttt9mOHTuiHhYAIJW0/6maXKrp
on501apVszfffJOaLgAQIN+PTvW5lI/ev39/+tEBQIBicxdV06VBgwb28ccf
sy8KAAHSnL5//343p2fKlMnq1atnCxcujHpYAIA4KSf9gw8+sNq1a1uBAgVc
D2nq6QJAmHz85bHHHrNcuXLZVVddZUlJScRfACBQykP/5JNPrHnz5q4/3Z13
3mm7du2KelgAgDhoTX7kyBF3zkg1AcqWLWsvvPACtRgBIFCav7/88kvXQ1rn
jm6++Wb3cwBAeLRWV72umTNnWsWKFe2yyy5z55DobQQAYdJ+qWoCKPfF56t/
9NFHUQ8LABAnrcvnzZtn11xzjeXOndv69Onj+h4BAMLjzyE98cQTrlZAlSpV
bPr06eQ2AkCg1GN6zZo1duutt7oYTKdOnWzbtm1RDwsAEAdfT/3ll1+2EiVK
uJrqWreHUqtR47/Q3yu4BlwDIJbm740bN1qvXr0sS5Ys1rRpU1u9enXUw/qP
NGbVlPz000/de4b2Bi60e9pfg88++8zWrl17QV8D9QRYsWKFpaSkRD0kIF3Q
vaD+pKqprlowQ4YMSZf3h/YAjh075urW3HLLLa5PU9WqVe2+++6zzz///II4
OxV7Ddq2bXvWa5DR53Zdg+PHj9uSJUtcD8Yrr7zS2rRp434O4F/3iGoEDBs2
zNUMqFOnjpsz0gvNUar/rvcHvU+UKVPGLr74Yvvd735nf/jDHyxnzpxWt25d
Gz9+vB04cMB9PhmNroFqO2jeHjBgwE9egyeffNK2b9+eYa+BenWpn+6DDz5o
FSpUcN+vefLksa5du9qmTZuiHiKQbmjOXLp0qes5rfnh7rvvdnkxUdM+ru5V
1R5Tbo7uYZ9TP3bsWFc/uHz58vbHP/7RChUqZC1btnT9m3SuKqOsV7X21t71
U0895dbkl1xyyf+5Bo888ohbq2pu13uWvobTpk1zdSAy0jXQmQrVsrj22mtd
HTqdg7766qttwoQJ7jmm+R7Av/haMM8884wVLFjQ1YJ58cUXI5sTdA/v3r3b
Jk+e7O5hrcW0LtW8rrlN9QwUgzh48KCrBa/8etWwUX34UqVKuXWb3sW1tg11
XlO8WO8dr7/+ul1//fWWP3/+09dA6/GzXYMiRYrYRRddZJdffrnLY9IZhNCv
gWLms2fPdrEmfW9qLlfMSWv1devWuWsQ6ucHpCWtiXWPdOzY0d03illv2LDh
vI5BMQM9W9577z2XY6k5SvOY8nIUM1ZdSd3DPrbgYxJaw2l9rjHrDJXWsZr7
tDewfv36YHJ5RJ+b3jMWLFhg7du3d/UbdA1Kliz5X6/BW2+95eY+XQN9DStV
qmSDBw92839I10Cf08mTJ2358uXWs2dP95zW56N3sS5dutiiRYvcXJ8RY0zA
uXJmLZiiRYvaqFGjzsveo4+ZK16sXqmlS5d297BiCZrX3n//fbdm1XPnp/68
+n5888039vzzz1utWrVcPEZzW/369d37uXpsp+c5wF8D5bEoZq53JeUi6XNo
3bq1e8793GugGIViM/7P+2ugd5/0fg30fPr6669dXE3P5Rw5crh4oGpE67mt
r+NPXQMA/5fWclu2bHHzquYDzQVpXQtG96f+TeXGq1eH4sX6uO6661zuvGKl
mut+7vi1htV+qvZ89WzwsfabbrrJzQla/6W3d3V/DRRTUYxYn7+uv/Y9p0yZ
4n4vNddA5w6U56l9CMXaFY9J79dAawft1b/00kvueaRnka6B9hAUb9u8ebN7
ZgFIHd03H374oTVs2NDFZbUPlxb8e4HWn40bN3Y1CrQ21z08evRoFzOJd+7R
/KA1reLJ3bt3d3FYxdo1x/fo0cPlM2tPLep5TWtm1dlRzKRJkyaWN29eN07N
w3pHSk5O/kXXQLF2xXCUL6QYjt9v6Ny5s4tfpJdroHibcq30Tla4cOHT8bYH
HnjAPZuImQPx8/OM9qU0rygWkBY05ygvTXOs5nLFi/V+oBjq0aNHf3H817/H
a52vWjbKidH6V7kz1atXt4ceesidt4oiFuHjxdrHVb8pneHNnDmz+//evXu7
Xz+X12Dnzp3uuaEYTux+g2Lt2kPRv3O+50z9ezoHsWrVKvd1176nj7clJiba
/Pnz3TMppH0AIL3SPKf7TXO75oS0+jf097/zzjs2fPhwt05T/uS5jpX6uUPP
D+X1KNau9apyaRo1auTyezR3nI85zcfMtWep/VvlYWp+1fpc+7u6FuobmxbX
QO9feoYp1q4zCLGxdl0X7bGej+ebf85oLHof8/E2xcz1vvbaa6+5Z1Bafd8B
ODd0L585Z8Q+O35uvDheWu9p7av3gIEDB7q4kmLtyq3x82lanrHXe4neGTR/
ak7VHKYYQ40aNdxz5dtvv03zM/663oq1q6bAo48+auXKlXPXQHmgWsMr1q5r
lFZj0Ndg37599uqrr7r8TD3L9H6id4Zx48a5/V19PxBnAdIv3Z+KhypGP2nS
JPfjKGkNrHlF7wXq4ac4vuYVvfvrrNWyZcvO6Rl7zWN6D9B8eeONN57OM1de
i+I/im2d7zNSPtaur4ly+TWna0zab+jWrZstXrzYrevP1Zh8TQP9e7fddpvb
r9W/p1hTv379XPyFmDkQBt3Pyj9TXovmUMUWouZjIFu3bnVnLlW7TLFcxdoV
C1C+iH7vl8QifMxH7wXap/Uxc82fqlOiPUq9n0QVLz5zv0HPG7076Br43P4v
vvjiF8WBfMxH7wWKmWvfU9dZ63OdP1COquJtF0KtHiBq/p7Xu7g+fio24udH
5S6otlLsHKXf0/2q+Kje9du1a+d+rLkyPeRJawzaq9Tcpfwe5RH+6U9/cmt3
xXaVR5jaWIS/borfjxgxwp370Typ2LWvXaCcvfRylt0/e5QT/uyzz1rNmjXd
fkNsrF3jTe3XS88CxZMUU9Eehq9poHyqqVOnpipHFcAvp/tNuektWrRw+cK6
t892D2odlpSU5Prg3XvvvafPteicn961tQ+mNZ/mSJ1l0pluzZ/6M4qBpAd6
DumZpLiL8ucUg1BOt9bWyq+bM2fOzzpj73OsFR/XfOhzTGrXru3mS+0LnsuY
xrnk4yOKgwwdOtRdAz3fFCdp1aqVzZo162fFR3xNgxkzZrjaMz62pZpbY8aM
cc+O9JgfD2R02q/TvOvvba2vlOt85r2o+1NzmN6nb775Zhez0H2tulM6Q6Pc
Eu0Jak9S97d+rFiH8ug0x6UXvu6fnjOaw5VPp7w6zUcJCQmunorOMmnuO/Ma
+Bzrd999181/+nPKK1HMXGeflGOtvcn08G7y3/jcfuUSKkakz0XrdsVNlNeu
2gRn28v1+6+KKSnGpjxzXTudR77nnnvctdM7TwjXAMiIYuf0X//61+7dWftn
WofGOtuc7uMPmh+1Lvv444/dfa25XD/WXK6/Jz2+e2vs+tx9rF01xDSn6Yy6
clRGjhzpYgp+bte6W/Ocro3mPc1jOuOkvHM9A/W+ElqOdWwNGdWK0PlTvW8o
Fl65cmUbNGiQqwXk89p1vZTnrnwi1QHWf+trGiifSN8HoV2DC4HPRTvbOuVC
cSFdg9g5/be//a2r5ao5S3GT2Nzhs83psXStFI/RvqP2xfTjEPhaWspLefzx
x935Vr2vKG9FzybFhPV7OpelPUXNY9pj1O+plqLmw9BzrH2sXfO3Ym/ab1BM
SvO1ajc899xz7kyuYuY6x+VrGuhdTGf8VdNA30dIX2L3fNR3QB9+nXIh0Xu5
ak7oXlZs1Ne6y6hzu5/TFXfQeXLFy/25ENVa937OnK68F8VSb7/9dvfjkCgW
obW28vv0rqEYktbtyl9RbEVnl7R+Vb6M5jbNfxktx9rH2tUvUOfD9GzXNdDz
TdfD1zTQ9dC+sO6NjFTDPiPx5ySefvpptx+ur52+jnpGKydAuVgZ/eumeVvz
kGp5K6as+KI+VF9J93A8OQEh8HO6ao8ob0F18lSTRHOYYsvKb5b/NqeLciAU
o9XaNcSaej7Wru8D1UxQ/o7Wqnp30fNOewOKF8fWwM2IfF679s6Vn6lroF5L
ip2rxoPyNrWvkJGvQaj8OQnd04qJ6X7VO5diivo6+vN3+t6eO3duhluXiO97
qO9fxQwUI9U10PulfqxroP9XrFE5ARltLz92TlcOh+KiEydOdHteWo/pjLnm
558zp2cUPnas91T1cFX9WvWj0L1yoeRY++ebclJVf03rPeWZ69zBhXINQuL3
fNSLW8/h4sWLu/iY8pm0B646d7q3O3To4PpH+Rwl1epXbDE91Hn7pfx9q89H
uXna89E10PuJPm/dy3qO6cyhrouvdafro72yjHANJHZO1/uJYg/a29QaXc81
xY0VS72Q5nRPz3tdHz3z00ue+fnmY7LKdUmPe9341/uxYoF6x9Z+h85JKH6q
dajmMT2H9f2r72XtfbzyyisuJ0BnfPXfKQdXuWvnqxZQWvDnY7QfpPio3ks0
n9erV899vsrP0/evPhSTUg6uzt9pXtcemfbR1B9Svxf6Pv+Zc7pi6Po1vbfo
6645XOe6dU0utDkdSM9i+x4qTu77t1arVs29V+kePXPv2ucEKH9J+Qy+FpDv
86v8p7SsBXSu+RqBmsO0/lQeteIs2h9UXoP2fM6MrcTW+9M7uHICfv/737u5
TddRtU1CugZnOtucruukOIOeearHra+78mAUk2FOB6KluSY2Xqz5WLEU7Wlr
z0fnpf/bubHYnAC9k2uvJLbPr87lpefcED8vK4agWIrvU6w4ufKNf04tb99b
R+fvdAZRf4ffb1BvT53BSK9nB0Xj8h+xzjani77misGozrfe5ZQHo689czoQ
DV+fQ3O2zgioHl1svFj7Hanp3+r3TJR3rPW5YhG+toPW+qo9p5hOeorH+Fig
xqXcK9Wx1vykWIvOwiu3QTkOqdnz0X/rzyAqZ0/XQM9I/d2qX+TrIaWnuV3j
UaxJY9acHZuT8lNzuugZpf0xncHRNdOzXF9v5nTg/NK8o/inz030ddh0z6r3
4y852xd7PkFnEXwtIOW+6e9X71/F5KOe03xuovLMFRdWrEl7Anr++Nz7X3IN
9Ge136DcR+V065yK5nf9WDEaX8MqSr6Ota9JqHNFeg7FntX/T3O6xq8/r5xz
5UH95je/cbEq5nTg/NA9qBiC1lba8/S16JWzorPOPl58rv4t3+c3thaQYhFt
27Z1a8IockPOrOGsHHPN5crtUcxEPeu1h38uxuXzILXfoOurd6Ezcx/P1b+V
Gj6vSfOz6pkoJu7jbTorqTF7/2lOF63p9e6h2h46Z6qvMXM6kLb8Pax4seLD
/h72ZwQU7z4XfQ/PxtcCUt6f1oB+DlVus2Kxvh5SWvO5iarhPGDAAPfvK9ak
55rmdo0vrfoe6u9UHEt7FrH1kGL7L2hdfz7mdj1HfbxN8SBfx7pNmzYur0nj
jB2HrpmePaqlqPcZjTWW76mpdYLeyfS1Vb8gvQcCOPe0jtJZdq0TtdbSPayY
p84C6l5Ni76HZ/KxCN3n6jOofBBfD0l5Inp3Vxwkreb22HOw+vd8j2HVClTc
4XzU5Ijt86va2b4eksaheI/i+fo6pdU18LEm1d9Qvqnf61B+pn7tbHlNomun
canPmNbrZzvT7/OF9MxS3ErvYHr/AHDu6B7WfK14sd6ZFe/08WLloG3atOm8
19XxazrFIlRP29dD0rpVNZY1v+q9/1z2C9M7gvZstefpa6bq2ab88bPlJqY1
/86k3Efl/+kMgJ5vypu84YYb3Nx5Lq+BjzVpHa38Ut8vTPmHOoOQnJz8H2ty
6Nf9OVHtk/zUe4z+HT23NXZ9fvrv0kvPCyBksfWLFetQ7FZzhq9f7Gs4R7lH
qbWf1nVLlixx51VU/0dzu2Laqs2s9/tfkhvi3wt0Dla5lPp7NZcrlt+zZ08X
E1Y9iijPA52t17H2FzXWTp06ubrV5+IaKLdS8R5f/1U5loq/qf5rWl0DxXd0
/lbvX4rnXKhnLIFfwt/DWnfpjL5ywxVnUT6H6rHovVhr1vRyrtHnPupdQjmD
2lfTePWh2K3vlRBPryzlm2ivT3u/ii/oGii3Uut15Wmkp/pRvtex+ijofIDy
gxTn17uE6lOrh3q810DvQv4a6EMxL10DXfO0jDVpPa+zVr4Pver4Afj5fG6i
YpmqWaw4teZG1QxULp1iuOl1reT3LhUL0jygOlFasyu/0tc8VP/Zn9MrS/+d
zu4rXzA21qSauIoJKyaQHsXWhFKs7FxcA98zzV8D5U/6nmlpTWsLxdQVV1JM
6f777z9n+VRARub3pvR+q1ipz030sVLliIdyL/m8P8WG1OdL7xmqYar4r3Iy
tI49W91H/VzxYMWadF4z9gyrr316LuPTaSm2/4J6Met9xdda0DXQ+8zZ4v8/
dQ3UR1OxrfN9DXz/C50z0x6w5nbtrwI4O7/XqPp/ykX0sVLd+126dHH3tmKl
IcxjZ4qtzay4r6+zr/x2fa6an3yc2Z+D9f2AFbNQ7EKxJuWfKy8vxLqfvtaC
6rfqGmitq/X2z70GWp/rDIDyMxVvi+IaKLajvQLl92he176Gr7UO4N90f+od
XbmJlSpVOt0rS3kjb7311um6iSGL7YOommKqJaJ5XXODzqGrXpj2UXVO1efl
aS5TvEG5khmlX9iZuY++7qPyMbWO1zXQuVzF23wNAvWtUG5i1NdA49dzSfFA
1ZtQrWLV+Eov+zlAeqBYqNZePjcxtleW9tIyWs+/2JqHyi1X7qNiEdrzVFzB
r18Va9Icpz7GGa0vh899VBxN86PP//ypa7B+/fp00y9M6w/li6rPsp65enfQ
9ymAf8coFWv2Z9m193Qh9MryNQ+Vm6i8P81l6pWlvAqdw1QMKqP3yvLXQGeB
lQ+jr////M//pOtr4OP8es/QO6VySfXcCf0dCjgXYnsPaV2uvIKoYqVR0eeq
vA7tF6hnmmpHprfcxLSmz9VfA/WgSO/XQM8YneFVfq3WIg0aNHC58QD+HWNV
DsOFutaJPdfINQjjGigmqDNUms+1h62aw7F1wgAA4fA1ebWvr73cypUru73v
9BDzBwCknnKxVKdA54WVu6O+K8rfAgCER2ty1beZMmWKOw+mMxXKZSK3EQDC
pD1u5Zuqppj2S5s3b+7q2QMAwqTzA++8846rF6CaocOHDw9inxcA8P/TfqnO
xmou17k5nYFVXi4AIEyqUaP8etV8UF2L7t27u5oWAIDwaL9U9bxU60A1JNUX
VXun5DYCQJh0Zkp1ldUHRHWL9P/UggGAMGlNrrOkqqOp+mOXXXaZO5OU0erQ
AcCFQrnpOnekvh3qzaX4umquAwDCE1trVGdL1adPvVAAAOFR/otqe9WrV8/V
9urTp4/rowEACIviLuqLrnr4ymds1KiRLVmyhNwXAAiQ6gRPnz7dEhIS3P6o
+hFq3Q4ACIvyGJOTk+322293PWZbtWrletwBAMKi2Ip67Kk3tnrZKY9RPavS
a58mAMBPUx31ZcuWuZqM6o9xxx132I4dO6IeFgAglZS7uGfPHhc7V57LVVdd
ZUlJSdRQB4AAaQ907ty5VqtWLcufP78NGDDAxWEAAGHRWnzz5s127733upiL
zoyuXLmS3EUACIyv7TJt2jQrU6aMFS9e3MaMGUMvDAAIkHJa1q5da+3bt3e5
i7fccgs1GAEgQFqjHz582CZMmGCFChU6XSud3EUACI/iKzrz36RJE8uVKxc9
jQAgUL7u4ogRI9x8XqNGDZs9e7b7dQBAWNTf4v3337fq1au7uMuQIUPsxIkT
UQ8LAJBKP/74o9sH7dmzp6uNfsMNN7h9UnIXASAsmre/++47mzp1qpUoUcJ9
jB071tUFAACERTktn376qctZ1Bpd/aO3bNkS9bAAAKmkNfrBgwdt3LhxVqBA
AatYsaK9+uqr1HQBgAApd3HhwoWub5HqdPXu3Zt+dAAQIK3Ft2/f7vJbVNOl
du3aNmfOHPZFASBAyl189913rWrVqnbppZfa8OHDXY86AEBYlLu4fv1669q1
q2XNmtX1vKAfHQCER7GVo0eP2ksvveT6RZcuXdqeeeYZaroAQICUd75ixQpr
2bKl5ciRwxITE23Xrl1RDwsAkEqq3bJv3z57/PHHLW/evFa5cmV74403yF0E
gACpH92CBQvsmmuusXz58ln//v1dHAYAEBatxXU+VP3odF5UOenLli0jdxEA
AnTq1ClLSkqyChUqWNGiRe2xxx5z+YwAgLAopyU5Odluv/12t0Zv3bo1/egA
IECKrRw5csSef/55K1y4sF1xxRXux8pRBwCERXO31uidOnWyzJkzW4cOHWz/
/v1RDwsAEAftjX777bd2zz33WKZMmaxhw4ZubxQAEKaUlBRX2+Xqq6+2/Pnz
u7pdymsEAIRHZ4327NljjzzyiOXOnft0/2jyGAEgTFqXL1myxPUaVW1d1e/a
vXt31MMCAMTB579MnDjR5acnJCTYpEmTWKsDQKCUp7527Vpr3769ZcmSxW6+
+WZq7AJAoLQmP378uE2fPt3Kly/vau2OHj2aGl4AECjN31u3brX777/fsmfP
7uq+LFq0KOphAQDipDovc+fOtTp16riau/369XOxdgBAeJTbqLOkY8aMcTV3
q1WrZjNnzmS/FAAC9cMPP9gnn3ziepEqBqP6Xtu2bYt6WACAOPi+pMpnLF68
uJUqVcrGjx/vetsBAMKj+l4bNmywHj16uPpeWrN/9tlnUQ8LABAn1YJRr4xK
lSpZoUKFbOjQoXby5MmohwUAiIP2S3fu3GkPPvig5ciRw+rVq2cffvhh1MMC
AMRJtWAWL15sTZo0sVy5clnv3r3t4MGDUQ8LABAH7ZceOnTIJkyYYAULFrQr
r7zSpk6dyvlSAAjUmbVg2rVrZxs3box6WACAOPhaMK+++qqVLFnSLr/8cnvy
ySfJbQSAQPk+d3379rWLL77Y1VpfsWJF1MMCAMTp1KlTNmfOHKtVq5YVKFDA
Bg8ebCdOnIh6WACAOCi3cd++fTZy5EjXD+mqq66yWbNmRT0sAECcVAtm2bJl
p2vBdO7c2fbu3Rv1sAAAcfB97p577jl3trRs2bL24osvktsIAIFSbmNycrIl
Jia6WjDqc7d+/fqohwUAiIPW6tobVV31ChUquD53o0aNcnEZAEB4tF+6Y8cO
GzhwoDuH1LBhQ/rcAUDA1Odu3rx5ds0117haMH369HF11wEA4VEM5sCBAzZ6
9Gg3p1epUsWmT59OnzsACJTqA+g8acuWLS1r1qzWqVMn2759e9TDAgDEQWvy
Y8eO2eTJk12fu2LFitkTTzzh4u0AgPAoN111Gu+++26X23jTTTe5XEcAQHh8
XF35jIq/qB/SwoULox4WACAOykv/+OOPrXHjxq7HXbdu3VwfDQBAWBQ33717
t40YMcLV9dIa/aOPPiL3BQACpPq7SUlJlpCQcLr+rn4NABCWH3/80e2N9urV
y8XRmzZtamvWrGGNDgABOnnypL388stWpEgRK1GihI0bN87V9wIAhEVnjVav
Xm1t2rRxa/TbbrvNtm7dGvWwAACppNiK8lrGjh1refLkserVq9tbb71FDXUA
CND3339vc+fOdX1JVeeld+/erk8GACAsvsbukCFDLFu2bNagQQNbvHgx+6IA
ECDlKb755pt2xRVXWOHChV1eOr0wACA8yl386quvrGvXrq4PRosWLeyLL76I
elgAgDgcP37cJk2a5HpLly9f3qZMmULuIgAESPGVJUuWWJMmTSx79ux2++23
265du6IeFgAglXzdxTFjxljOnDmtRo0aNnv2bHIXASBAyl2cM2eOy0PPmzev
DRgwwMVhAABh0Vpc50Pvu+8+ty/asGFDW7ZsGbmLABAg1XSZNm2a60lXqlQp
e+aZZ4i5AECAVNNl5cqVrhedetLdcssttmXLlqiHBQBIJcVWjh49ahMmTHDn
/6tUqWIzZsygdzQABEj7ovPnz7c6deq4/kU9e/a0w4cPRz0sAEAqKV6+bdu2
0/ui9KMDgHCppsusWbPcWdGiRYvayJEjXWwdABAWnfVPTk62Tp06WaZMmaxZ
s2bu5wCA8Ogskeq4XHrppVa2bFl78cUXyV0EgAApvqLzRFqbq6ZLly5d7ODB
g1EPCwCQSspR3Lt3rz366KOWI0cOq1atmiUlJbEvCgAB8v3oVJ8rX758NnDg
QLdXCgAIi+LlmzZtsj59+rh9UfWjU11dAEB4UlJS3BlR9aMrXry4Pfnkk66n
EQAgLMpdXLt2rd1666128cUXW9u2bd15IwBAWLT/qfP+48ePd3XRExISbPLk
yeyLAkCAtEZfs2aNtWvXztVdvOOOO+zYsWNRDwsAEAftjap2br9+/eyiiy6y
+vXr2+LFi6MeFgAgTsphnDdvntWtW9fy5Mnj6nbp1wAA4dFZo/3799vo0aNd
nfSqVavazJkziakDQKBUE2DFihWun1G2bNksMTHRduzYEfWwAABx0Jrc1+5S
bV31HX322WdZqwNAoHTG6Msvv7Q777zT5anfeOON9vnnn0c9LABAnFTf5e23
37aKFStaoUKF7OGHH6bOLgAESvP31q1bbcCAAa7ui3JhPvzww6iHBQCI0w8/
/GALFy50dbxy5szpctepzwgAYdK+6KFDh+zpp5929QIUh3nttdfYLwWAQCm3
cfXq1da6dWvLkiWLq++l86YAgDCdPHnSrc9LlCjhPlTni7U6AIRJuY0bNmyw
u+66y9WCady4sa1cuTLqYQEA4qS90Xfffdf1Ji1QoIANGzbM1XIEAIRHtWB2
7txpgwcPdnH1mjVr2nvvvRf1sAAAcVJu46JFi+zaa6+1HDlyWK9evVysHQAQ
Hu2Lqk/GxIkTrWDBgla+fHmbOnUq+6UAEKjYfkiqBaMcR+2fAgDCpHjL9OnT
rUyZMlasWDF76qmnXLwdABAe1YLZtGmTi6crt7FRo0a2dOnSqIcFAIiTetp9
8MEHdvXVV1u+fPls0KBB9LkDgEAp1rJnzx5Xgzd79uxWvXp1V5sXABAm5TYq
5tKkSRPX565bt2525MiRqIcFAIiDchi/++47mzRpkhUpUsTKlSvnfkxuIwCE
SbmN69ats44dO7r9UvW5++KLL6IeFgAgTikpKfbWW29ZQkKC60v9+OOPu7pf
AIDw+D539957r2XOnNnq16/v+iMBAMKkPEb1K61du7blyZPH9THV+h0AEB7l
Nu7fv99GjRrlepeqJq/iMQCAMKnP3fLly6158+auHm9iYqLt27cv6mEBAOJ0
4sQJV6vxsssuc/Vgnn/+eWrBAECglO+yfv1669y5s2XKlMmaNm3q6jgCAMKk
PnezZs2yypUrW40aNWz27NlRDwkAECd/vnTVqlX20UcfuXgMACBsiqPrg1oB
AAAAAAAAAAAAAACcX/8L6YKfvQ==
"], {{0, 347.}, {373., 0}}, {0, 255},
ColorFunction->RGBColor,
ImageResolution->72],
BoxForm`ImageTag["Byte", ColorSpace -> "RGB", Interleaving -> True],
Selectable->False],
DefaultBaseStyle->"ImageGraphics",
ImageSize->{57.40625, Computerized},
ImageSizeRaw->{373., 347.},
PlotRange->{{0, 373.}, {0, 347.}}]), 
     CloudGet["https://wolfr.am/KR7FBcsM"]}], MoleculeEquivalentQ]]

One thing else that’s new in 12.1—and a primary signal of one thing massive to return—is the power to import knowledge about molecular orbitals:

Import
&#10005

Import["ExampleData/Pyridinecarbonitrile_MO_25_29.cub", "Graphics3D"]

Extra in Chemistry (Might 2021)

Chemistry is a serious new space for Wolfram Language. In Model 12.0 we launched Molecule as a symbolic illustration of a molecule, and we’ve steadily been increasing what will be carried out with it.

In Model 12.3, for instance, there are new properties for Molecule, like "TautomerList" (attainable reconfigurations in answer):

&#10005

MoleculePlot /@ Molecule[{"C", 
Atom["C", "HydrogenCount" -> 1], "C", "O", "N", "C", "C", "O", "O", 
    "N"}, {
Bond[{1, 2}, "Single"], 
Bond[{2, 3}, "Single"], 
Bond[{3, 4}, "Double"], 
Bond[{3, 5}, "Single"], 
Bond[{5, 6}, "Single"], 
Bond[{6, 7}, "Single"], 
Bond[{7, 8}, "Double"], 
Bond[{7, 9}, "Single"], 
Bond[{2, 10}, "Single"]}, {StereochemistryElements -> {
Affiliation[
      "StereoType" -> "Tetrahedral", "ChiralCenter" -> 2, "Direction" -> 
       "Clockwise"]}}]["TautomerList"]

There are additionally comfort features like MoleculeName:

&#10005

MoleculeName["CCCCCC(CC(CC)C)CCC"]

And, sure, with MoleculeRecognize you may simply clip a construction diagram from a publication and discover the identify of the molecule:

&#10005

MoleculeName[MoleculeRecognize[CloudGet["http://wolfr.am/VAsdfYsh"]]]

Given a set of molecules, a query one usually needs to ask is “What’s in widespread between these molecules?” In Model 12.3 we now have the operate MoleculeMaximumCommonSubstructure, which is the molecular construction analog of LongestCommonSubsequence:

&#10005

mcs = MoleculeMaximumCommonSubstructure[{Molecule[{
    "N", "C", "N", "C", "N", "C", "C", "N", "C", "N", "C", "O", "C", 
     "C", "O", "C", "O", "C", "O", "H", "H", "H", "H", "H", "H", "H", 
     "H", "H", "H", "H", "H", "H"}, {
Bond[{1, 2}, "Single"], 
Bond[{2, 3}, "Aromatic"], 
Bond[{3, 4}, "Aromatic"], 
Bond[{4, 5}, "Aromatic"], 
Bond[{5, 6}, "Aromatic"], 
Bond[{6, 7}, "Aromatic"], 
Bond[{7, 8}, "Aromatic"], 
Bond[{8, 9}, "Aromatic"], 
Bond[{9, 10}, "Aromatic"], 
Bond[{10, 11}, "Single"], 
Bond[{11, 12}, "Single"], 
Bond[{12, 13}, "Single"], 
Bond[{13, 14}, "Single"], 
Bond[{14, 15}, "Single"], 
Bond[{13, 16}, "Single"], 
Bond[{16, 17}, "Single"], 
Bond[{16, 18}, "Single"], 
Bond[{18, 19}, "Single"], 
Bond[{7, 2}, "Aromatic"], 
Bond[{18, 11}, "Single"], 
Bond[{10, 6}, "Aromatic"], 
Bond[{1, 20}, "Single"], 
Bond[{1, 21}, "Single"], 
Bond[{4, 22}, "Single"], 
Bond[{9, 23}, "Single"], 
Bond[{11, 24}, "Single"], 
Bond[{13, 25}, "Single"], 
Bond[{14, 26}, "Single"], 
Bond[{14, 27}, "Single"], 
Bond[{15, 28}, "Single"], 
Bond[{16, 29}, "Single"], 
Bond[{17, 30}, "Single"], 
Bond[{18, 31}, "Single"], 
Bond[{19, 32}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{32, 3}, {CompressedData["
1:eJwBEQPu/CFib1JlAgAAACAAAAADAAAAzGgnqNJ5IEDneLE7oYUiQOeZck95
ff+/WgrO3ct+G0CPEFbjncUhQP0IJt7BcP6/4gblAC9IGEDz+GPsJ+ghQDRB
k4KQAwjAZH7TWnYYE0DkYTL/MzQhQBaZq7NHrAfAYZLzYVvREEAMMlkVJVQg
QA4+ERMkKf2/zQwfEMHDE0Bd7Fb46yIgQOj7cd09vOW/NLl1O1wXGUCd6ErB
td4gQIgTW+Vo3ue/5rBCO9z6GkA9Bt0dSHwgQFGPmTSKE+A/XO33YewKF0CQ
BNWQbyEfQJfTkZt1wvQ/oHnboSGNEkBbVeq5d7AeQPRC7Z2dMeI/E0KOrg3n
CkD2m7ea+dYcQNPeFS8TJPE/QB/2bwjkC0Asnpdf3xoaQLb+A0LBBgJAjPZJ
y16gC0DNzPceibQUQO6Sg7qH+f8/Aus9RoQBE0A+jMweEaYSQLQW3yN/ePY/
BmT0DKh0EkDj//9YRV0KQE5p87JV+fI/7MqzIdT/AkAs7t9wlkkUQOephZBb
3O0/BmoEJDd18j8zYHkpjNAUQNRKvVK4cvk/+cmySF1vBUCmdtTovCgZQDhj
uOtDn7Q/2gFOKqNi9z+t/DtbTzQbQEqUa7Eg/9a/pSVtLFDmIUCS9o+ujT4h
QFV20ZQn6gLAi7VntykWIUCEjaO9s18kQES+NPvT4fm/xsg8J6zWEEB0qZhj
0GEhQD7K4oiNKg/ACAq4pDl4F0DsKddgbC0eQF3TZifqyQJAVE3KLT9LBUCO
ndocBCkgQAOqLvTAq/M/jjFOtjmJCUA6Xxc9Q3oSQJYJ2UlbTAdAliQpYDKO
E0DISN/v3owUQGzE9tkdm9k/mDrvyHN1FkCTdFRPxkYTQI9UunG1dgBAmAPP
LnUdEEDsEQ+K7O8GQKKatQ8Gxf0/ZiqswoCQA0B/4ppszoAQQCwkltOHLtc/
2pLZFNux8z8KYh2IWgoXQKy13XD5NQNAuBxwEWSmCkDOWdFW+ScYQNCXWmaf
A+m/iGJlVhMj9T+9WsEe8PceQIzEjnFC2sC/yMJgeQ==
"], "Angstroms", {{1}, {
         2}}}]], StereochemistryElements -> {
Affiliation[
       "StereoType" -> "Tetrahedral", "ChiralCenter" -> 11, 
        "Direction" -> "Counterclockwise"], 
Affiliation[
       "StereoType" -> "Tetrahedral", "ChiralCenter" -> 13, 
        "Direction" -> "Counterclockwise"], 
Affiliation[
       "StereoType" -> "Tetrahedral", "ChiralCenter" -> 16, 
        "Direction" -> "Clockwise"], 
Affiliation[
       "StereoType" -> "Tetrahedral", "ChiralCenter" -> 18, 
        "Direction" -> "Clockwise"]}}], 
   Molecule[{
    "N", "C", "N", "C", "N", "C", "C", "N", "C", "N", "C", "O", "C", 
     "C", "O", "P", "O", "O", "O", "P", "O", "O", "O", "P", "O", "O", 
     "O", "C", "O", "C", "O", "H", "H", "H", "H", "H", "H", "H", "H", 
     "H", "H", "H", "H", "H", "H", "H", "H"}, {
Bond[{1, 2}, "Single"], 
Bond[{2, 3}, "Aromatic"], 
Bond[{3, 4}, "Aromatic"], 
Bond[{4, 5}, "Aromatic"], 
Bond[{5, 6}, "Aromatic"], 
Bond[{6, 7}, "Aromatic"], 
Bond[{7, 8}, "Aromatic"], 
Bond[{8, 9}, "Aromatic"], 
Bond[{9, 10}, "Aromatic"], 
Bond[{10, 11}, "Single"], 
Bond[{11, 12}, "Single"], 
Bond[{12, 13}, "Single"], 
Bond[{13, 14}, "Single"], 
Bond[{14, 15}, "Single"], 
Bond[{15, 16}, "Single"], 
Bond[{16, 17}, "Double"], 
Bond[{16, 18}, "Single"], 
Bond[{16, 19}, "Single"], 
Bond[{19, 20}, "Single"], 
Bond[{20, 21}, "Double"], 
Bond[{20, 22}, "Single"], 
Bond[{20, 23}, "Single"], 
Bond[{23, 24}, "Single"], 
Bond[{24, 25}, "Double"], 
Bond[{24, 26}, "Single"], 
Bond[{24, 27}, "Single"], 
Bond[{13, 28}, "Single"], 
Bond[{28, 29}, "Single"], 
Bond[{28, 30}, "Single"], 
Bond[{30, 31}, "Single"], 
Bond[{7, 2}, "Aromatic"], 
Bond[{30, 11}, "Single"], 
Bond[{10, 6}, "Aromatic"], 
Bond[{1, 32}, "Single"], 
Bond[{1, 33}, "Single"], 
Bond[{4, 34}, "Single"], 
Bond[{9, 35}, "Single"], 
Bond[{11, 36}, "Single"], 
Bond[{13, 37}, "Single"], 
Bond[{14, 38}, "Single"], 
Bond[{14, 39}, "Single"], 
Bond[{18, 40}, "Single"], 
Bond[{22, 41}, "Single"], 
Bond[{26, 42}, "Single"], 
Bond[{27, 43}, "Single"], 
Bond[{28, 44}, "Single"], 
Bond[{29, 45}, "Single"], 
Bond[{30, 46}, "Single"], 
Bond[{31, 47}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{47, 3}, {CompressedData["
1:eJwNz3840wkAx/HFWjYts7FfbeO7H36s0eFyeqh98oRzWLK6cJWrEKrVce2u
hZMfcSl0CsWloi76QZLH5R6s0iIViqtnV90tobqU0kkP6/zx+uP955vYuD0i
zoJEIi2cYTmjOizEYHrFxXjt857x81bo9jm3n/aEhhZlbKRLqB1qgtbmv5bT
cGWyMTColgGtd6f1ch8GPL3uNOzmWILyJ3dFwikG5AMOUtHhOZi3q3uTx2Yy
XA88jaY3sFBdLhnof0bBM63ORm1Px7Loqgt/G9lYvy0guerQPHy3zO37bD8m
9l9/GX/WgQNzQt+ZPZ0sxCZzS4d0tnDvvhq7cIIFfUrYwZ7/2DAnZu7yuWyP
qcXUoNlTdliV87Y7pdAO0UJGvvwpF4Er2YP0g1xgc+pgXYkNrvfs++zjbTaq
Nkypp8d4eKfp/0EvssL4Py82WjjyQCs1rHvbLERSc9oGfeMcNIgK7nMLRRg2
xlzUBgjhbQo8RZ5LhWWaxmel1hFXLsuEJUwC+j0KmTWdiWuXqE45hQR+jhO8
vJlDzLTMb/tOJojL/Ud4LWKUHD5t6KJIQatner7L5qKlJlTBMkswV6dU3a2S
YjSTkqkS8TCcazqf0e4Esh+SeJESHEj4i1+eIYTJMzwvzV4Ma5dBDze1BP7X
vR4ZtvFge9tNIdkmhbVu0qdwzBncne5prXQh2pdNW/M+EGDn3EXxaldEpLeW
+8cJcDqpda1vrQix+QNG4ZQzHqjudewVzkfC3upOdSOBn3KD3SJLFIicr0//
upPAWc2W6pFXYtg3Lgl56OuKyBG+7pyNGIJPYZk6thPK5Ava5u+RY0idSJMX
iHG168a/JpYLyInlZo3KBckjLUfbb0qhYo9amplO6K0P8ldlK+CqoIdEl4iQ
9+PEFwdmfpktwx7rghUwn8gaYDVRcD9qdOu1ZgH4QYb40QUShPS/Xlr05YQy
ayxga8EWAd4e8iUxtBKs+kjmHb1CQ1b0IuPqRg5cr9rYTzURYOyoPc4ykLG+
oSl8+04WPhjyHlMviMHbdMno8YqPW2p1ReXgPHw1UiTQf6Sgp+14fWE6H2VR
nS/vWsyCfqMxIP4BFR7FF4vLpLOQokn6RvxuSvl5nTIjoYiF4PrgymPebCwl
DXXE/yKA8x3RuLuAD5J8ad6i7E/Kyo7dixOLOWjuWlMTYRbA0uSoG2+zwAdv
QvQtRYx7yf5rLMMIxMrW9EbtYMEzyc+66qEYv+ZPPrp1zQHkcHqtsMcOnBUr
3YoKHFBnTBmmFxF4E7PjTI2XI2ZXJKdSpgkER5bZDtVIYfVHteaGlINc29/3
vZ8rhvax+4vJKgVOdssD/YOcIJrYF/FEJoOmo9Quu3oBulKfZsfMEuH5dOWZ
9gsu6CX63h8pVYDIehS7ZISGGl/tw4D1QuyPYTU/o8twonwy3Wr4jXJE2abq
K+ahMzT3NCNajKah5cO/VdhCpjJOZ1E5iHNx5lOZYhzzUpjCT5LQVxF2LKPE
Fq29x8dSQwn8D14J2II=
"], "Angstroms", {{1}, {2}}}]], 
     StereochemistryElements -> {
Affiliation[
       "StereoType" -> "Tetrahedral", "ChiralCenter" -> 11, 
        "Direction" -> "Counterclockwise"], 
Affiliation[
       "StereoType" -> "Tetrahedral", "ChiralCenter" -> 13, 
        "Direction" -> "Counterclockwise"], 
Affiliation[
       "StereoType" -> "Tetrahedral", "ChiralCenter" -> 28, 
        "Direction" -> "Clockwise"], 
Affiliation[
       "StereoType" -> "Tetrahedral", "ChiralCenter" -> 30, 
        "Direction" -> "Clockwise"]}}]}]

Right here’s a diagram of the widespread half:

&#10005

MoleculePlot[Molecule[{
  "N", "C", "N", "C", "N", "C", "C", "N", "C", "N", "C", "O", "C", 
   "C", "O", "P", "O", "O", "O", "P", "O", "O", "O", "P", "O", "O", 
   "O", "C", "O", "C", "O", "H", "H", "H", "H", "H", "H", "H", "H", 
   "H", "H", "H", "H", "H", "H", "H", "H"}, {
Bond[{1, 2}, "Single"], 
Bond[{2, 3}, "Aromatic"], 
Bond[{3, 4}, "Aromatic"], 
Bond[{4, 5}, "Aromatic"], 
Bond[{5, 6}, "Aromatic"], 
Bond[{6, 7}, "Aromatic"], 
Bond[{7, 8}, "Aromatic"], 
Bond[{8, 9}, "Aromatic"], 
Bond[{9, 10}, "Aromatic"], 
Bond[{10, 11}, "Single"], 
Bond[{11, 12}, "Single"], 
Bond[{12, 13}, "Single"], 
Bond[{13, 14}, "Single"], 
Bond[{14, 15}, "Single"], 
Bond[{15, 16}, "Single"], 
Bond[{16, 17}, "Double"], 
Bond[{16, 18}, "Single"], 
Bond[{16, 19}, "Single"], 
Bond[{19, 20}, "Single"], 
Bond[{20, 21}, "Double"], 
Bond[{20, 22}, "Single"], 
Bond[{20, 23}, "Single"], 
Bond[{23, 24}, "Single"], 
Bond[{24, 25}, "Double"], 
Bond[{24, 26}, "Single"], 
Bond[{24, 27}, "Single"], 
Bond[{13, 28}, "Single"], 
Bond[{28, 29}, "Single"], 
Bond[{28, 30}, "Single"], 
Bond[{30, 31}, "Single"], 
Bond[{7, 2}, "Aromatic"], 
Bond[{30, 11}, "Single"], 
Bond[{10, 6}, "Aromatic"], 
Bond[{1, 32}, "Single"], 
Bond[{1, 33}, "Single"], 
Bond[{4, 34}, "Single"], 
Bond[{9, 35}, "Single"], 
Bond[{11, 36}, "Single"], 
Bond[{13, 37}, "Single"], 
Bond[{14, 38}, "Single"], 
Bond[{14, 39}, "Single"], 
Bond[{18, 40}, "Single"], 
Bond[{22, 41}, "Single"], 
Bond[{26, 42}, "Single"], 
Bond[{27, 43}, "Single"], 
Bond[{28, 44}, "Single"], 
Bond[{29, 45}, "Single"], 
Bond[{30, 46}, "Single"], 
Bond[{31, 47}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{47, 3}, {CompressedData["
1:eJwNz3840wkAx/HFWjYts7FfbeO7H36s0eFyeqh98oRzWLK6cJWrEKrVce2u
hZMfcSl0CsWloi76QZLH5R6s0iIViqtnV90tobqU0kkP6/zx+uP955vYuD0i
zoJEIi2cYTmjOizEYHrFxXjt857x81bo9jm3n/aEhhZlbKRLqB1qgtbmv5bT
cGWyMTColgGtd6f1ch8GPL3uNOzmWILyJ3dFwikG5AMOUtHhOZi3q3uTx2Yy
XA88jaY3sFBdLhnof0bBM63ORm1Px7Loqgt/G9lYvy0guerQPHy3zO37bD8m
9l9/GX/WgQNzQt+ZPZ0sxCZzS4d0tnDvvhq7cIIFfUrYwZ7/2DAnZu7yuWyP
qcXUoNlTdliV87Y7pdAO0UJGvvwpF4Er2YP0g1xgc+pgXYkNrvfs++zjbTaq
Nkypp8d4eKfp/0EvssL4Py82WjjyQCs1rHvbLERSc9oGfeMcNIgK7nMLRRg2
xlzUBgjhbQo8RZ5LhWWaxmel1hFXLsuEJUwC+j0KmTWdiWuXqE45hQR+jhO8
vJlDzLTMb/tOJojL/Ud4LWKUHD5t6KJIQatner7L5qKlJlTBMkswV6dU3a2S
YjSTkqkS8TCcazqf0e4Esh+SeJESHEj4i1+eIYTJMzwvzV4Ma5dBDze1BP7X
vR4ZtvFge9tNIdkmhbVu0qdwzBncne5prXQh2pdNW/M+EGDn3EXxaldEpLeW
+8cJcDqpda1vrQix+QNG4ZQzHqjudewVzkfC3upOdSOBn3KD3SJLFIicr0//
upPAWc2W6pFXYtg3Lgl56OuKyBG+7pyNGIJPYZk6thPK5Ava5u+RY0idSJMX
iHG168a/JpYLyInlZo3KBckjLUfbb0qhYo9amplO6K0P8ldlK+CqoIdEl4iQ
9+PEFwdmfpktwx7rghUwn8gaYDVRcD9qdOu1ZgH4QYb40QUShPS/Xlr05YQy
ayxga8EWAd4e8iUxtBKs+kjmHb1CQ1b0IuPqRg5cr9rYTzURYOyoPc4ykLG+
oSl8+04WPhjyHlMviMHbdMno8YqPW2p1ReXgPHw1UiTQf6Sgp+14fWE6H2VR
nS/vWsyCfqMxIP4BFR7FF4vLpLOQokn6RvxuSvl5nTIjoYiF4PrgymPebCwl
DXXE/yKA8x3RuLuAD5J8ad6i7E/Kyo7dixOLOWjuWlMTYRbA0uSoG2+zwAdv
QvQtRYx7yf5rLMMIxMrW9EbtYMEzyc+66qEYv+ZPPrp1zQHkcHqtsMcOnBUr
3YoKHFBnTBmmFxF4E7PjTI2XI2ZXJKdSpgkER5bZDtVIYfVHteaGlINc29/3
vZ8rhvax+4vJKgVOdssD/YOcIJrYF/FEJoOmo9Quu3oBulKfZsfMEuH5dOWZ
9gsu6CX63h8pVYDIehS7ZISGGl/tw4D1QuyPYTU/o8twonwy3Wr4jXJE2abq
K+ahMzT3NCNajKah5cO/VdhCpjJOZ1E5iHNx5lOZYhzzUpjCT5LQVxF2LKPE
Fq29x8dSQwn8D14J2II=
"], "Angstroms", {{1}, {2}}}]], 
   StereochemistryElements -> {
Affiliation[
     "StereoType" -> "Tetrahedral", "ChiralCenter" -> 11, "Direction" -> 
      "Counterclockwise"], 
Affiliation[
     "StereoType" -> "Tetrahedral", "ChiralCenter" -> 13, "Direction" -> 
      "Counterclockwise"], 
Affiliation[
     "StereoType" -> "Tetrahedral", "ChiralCenter" -> 28, "Direction" -> 
      "Clockwise"], 
Affiliation[
     "StereoType" -> "Tetrahedral", "ChiralCenter" -> 30, "Direction" -> 
      "Clockwise"]}}], %]

And now with MoleculeAlign we will see how the molecules really align in 3D:

&#10005

MoleculePlot3D[
 MoleculeAlign[
  Molecule[{
   "N", "C", "N", "C", "N", "C", "C", "N", "C", "N", "C", "O", "C", 
    "C", "O", "C", "O", "C", "O", "H", "H", "H", "H", "H", "H", "H", 
    "H", "H", "H", "H", "H", "H"}, {
Bond[{1, 2}, "Single"], 
Bond[{2, 3}, "Aromatic"], 
Bond[{3, 4}, "Aromatic"], 
Bond[{4, 5}, "Aromatic"], 
Bond[{5, 6}, "Aromatic"], 
Bond[{6, 7}, "Aromatic"], 
Bond[{7, 8}, "Aromatic"], 
Bond[{8, 9}, "Aromatic"], 
Bond[{9, 10}, "Aromatic"], 
Bond[{10, 11}, "Single"], 
Bond[{11, 12}, "Single"], 
Bond[{12, 13}, "Single"], 
Bond[{13, 14}, "Single"], 
Bond[{14, 15}, "Single"], 
Bond[{13, 16}, "Single"], 
Bond[{16, 17}, "Single"], 
Bond[{16, 18}, "Single"], 
Bond[{18, 19}, "Single"], 
Bond[{7, 2}, "Aromatic"], 
Bond[{18, 11}, "Single"], 
Bond[{10, 6}, "Aromatic"], 
Bond[{1, 20}, "Single"], 
Bond[{1, 21}, "Single"], 
Bond[{4, 22}, "Single"], 
Bond[{9, 23}, "Single"], 
Bond[{11, 24}, "Single"], 
Bond[{13, 25}, "Single"], 
Bond[{14, 26}, "Single"], 
Bond[{14, 27}, "Single"], 
Bond[{15, 28}, "Single"], 
Bond[{16, 29}, "Single"], 
Bond[{17, 30}, "Single"], 
Bond[{18, 31}, "Single"], 
Bond[{19, 32}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{32, 3}, {CompressedData["
1:eJwBEQPu/CFib1JlAgAAACAAAAADAAAAzGgnqNJ5IEDneLE7oYUiQOeZck95
ff+/WgrO3ct+G0CPEFbjncUhQP0IJt7BcP6/4gblAC9IGEDz+GPsJ+ghQDRB
k4KQAwjAZH7TWnYYE0DkYTL/MzQhQBaZq7NHrAfAYZLzYVvREEAMMlkVJVQg
QA4+ERMkKf2/zQwfEMHDE0Bd7Fb46yIgQOj7cd09vOW/NLl1O1wXGUCd6ErB
td4gQIgTW+Vo3ue/5rBCO9z6GkA9Bt0dSHwgQFGPmTSKE+A/XO33YewKF0CQ
BNWQbyEfQJfTkZt1wvQ/oHnboSGNEkBbVeq5d7AeQPRC7Z2dMeI/E0KOrg3n
CkD2m7ea+dYcQNPeFS8TJPE/QB/2bwjkC0Asnpdf3xoaQLb+A0LBBgJAjPZJ
y16gC0DNzPceibQUQO6Sg7qH+f8/Aus9RoQBE0A+jMweEaYSQLQW3yN/ePY/
BmT0DKh0EkDj//9YRV0KQE5p87JV+fI/7MqzIdT/AkAs7t9wlkkUQOephZBb
3O0/BmoEJDd18j8zYHkpjNAUQNRKvVK4cvk/+cmySF1vBUCmdtTovCgZQDhj
uOtDn7Q/2gFOKqNi9z+t/DtbTzQbQEqUa7Eg/9a/pSVtLFDmIUCS9o+ujT4h
QFV20ZQn6gLAi7VntykWIUCEjaO9s18kQES+NPvT4fm/xsg8J6zWEEB0qZhj
0GEhQD7K4oiNKg/ACAq4pDl4F0DsKddgbC0eQF3TZifqyQJAVE3KLT9LBUCO
ndocBCkgQAOqLvTAq/M/jjFOtjmJCUA6Xxc9Q3oSQJYJ2UlbTAdAliQpYDKO
E0DISN/v3owUQGzE9tkdm9k/mDrvyHN1FkCTdFRPxkYTQI9UunG1dgBAmAPP
LnUdEEDsEQ+K7O8GQKKatQ8Gxf0/ZiqswoCQA0B/4ppszoAQQCwkltOHLtc/
2pLZFNux8z8KYh2IWgoXQKy13XD5NQNAuBxwEWSmCkDOWdFW+ScYQNCXWmaf
A+m/iGJlVhMj9T+9WsEe8PceQIzEjnFC2sC/yMJgeQ==
"], "Angstroms", {{1}, {
        2}}}]], StereochemistryElements -> {
Affiliation[
      "StereoType" -> "Tetrahedral", "ChiralCenter" -> 11, 
       "Direction" -> "Counterclockwise"], 
Affiliation[
      "StereoType" -> "Tetrahedral", "ChiralCenter" -> 13, 
       "Direction" -> "Counterclockwise"], 
Affiliation[
      "StereoType" -> "Tetrahedral", "ChiralCenter" -> 16, 
       "Direction" -> "Clockwise"], 
Affiliation[
      "StereoType" -> "Tetrahedral", "ChiralCenter" -> 18, 
       "Direction" -> "Clockwise"]}}], 
  Molecule[{
   "N", "C", "N", "C", "N", "C", "C", "N", "C", "N", "C", "O", "C", 
    "C", "O", "P", "O", "O", "O", "P", "O", "O", "O", "P", "O", "O", 
    "O", "C", "O", "C", "O", "H", "H", "H", "H", "H", "H", "H", "H", 
    "H", "H", "H", "H", "H", "H", "H", "H"}, {
Bond[{1, 2}, "Single"], 
Bond[{2, 3}, "Aromatic"], 
Bond[{3, 4}, "Aromatic"], 
Bond[{4, 5}, "Aromatic"], 
Bond[{5, 6}, "Aromatic"], 
Bond[{6, 7}, "Aromatic"], 
Bond[{7, 8}, "Aromatic"], 
Bond[{8, 9}, "Aromatic"], 
Bond[{9, 10}, "Aromatic"], 
Bond[{10, 11}, "Single"], 
Bond[{11, 12}, "Single"], 
Bond[{12, 13}, "Single"], 
Bond[{13, 14}, "Single"], 
Bond[{14, 15}, "Single"], 
Bond[{15, 16}, "Single"], 
Bond[{16, 17}, "Double"], 
Bond[{16, 18}, "Single"], 
Bond[{16, 19}, "Single"], 
Bond[{19, 20}, "Single"], 
Bond[{20, 21}, "Double"], 
Bond[{20, 22}, "Single"], 
Bond[{20, 23}, "Single"], 
Bond[{23, 24}, "Single"], 
Bond[{24, 25}, "Double"], 
Bond[{24, 26}, "Single"], 
Bond[{24, 27}, "Single"], 
Bond[{13, 28}, "Single"], 
Bond[{28, 29}, "Single"], 
Bond[{28, 30}, "Single"], 
Bond[{30, 31}, "Single"], 
Bond[{7, 2}, "Aromatic"], 
Bond[{30, 11}, "Single"], 
Bond[{10, 6}, "Aromatic"], 
Bond[{1, 32}, "Single"], 
Bond[{1, 33}, "Single"], 
Bond[{4, 34}, "Single"], 
Bond[{9, 35}, "Single"], 
Bond[{11, 36}, "Single"], 
Bond[{13, 37}, "Single"], 
Bond[{14, 38}, "Single"], 
Bond[{14, 39}, "Single"], 
Bond[{18, 40}, "Single"], 
Bond[{22, 41}, "Single"], 
Bond[{26, 42}, "Single"], 
Bond[{27, 43}, "Single"], 
Bond[{28, 44}, "Single"], 
Bond[{29, 45}, "Single"], 
Bond[{30, 46}, "Single"], 
Bond[{31, 47}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{47, 3}, {CompressedData["
1:eJwNz3840wkAx/HFWjYts7FfbeO7H36s0eFyeqh98oRzWLK6cJWrEKrVce2u
hZMfcSl0CsWloi76QZLH5R6s0iIViqtnV90tobqU0kkP6/zx+uP955vYuD0i
zoJEIi2cYTmjOizEYHrFxXjt857x81bo9jm3n/aEhhZlbKRLqB1qgtbmv5bT
cGWyMTColgGtd6f1ch8GPL3uNOzmWILyJ3dFwikG5AMOUtHhOZi3q3uTx2Yy
XA88jaY3sFBdLhnof0bBM63ORm1Px7Loqgt/G9lYvy0guerQPHy3zO37bD8m
9l9/GX/WgQNzQt+ZPZ0sxCZzS4d0tnDvvhq7cIIFfUrYwZ7/2DAnZu7yuWyP
qcXUoNlTdliV87Y7pdAO0UJGvvwpF4Er2YP0g1xgc+pgXYkNrvfs++zjbTaq
Nkypp8d4eKfp/0EvssL4Py82WjjyQCs1rHvbLERSc9oGfeMcNIgK7nMLRRg2
xlzUBgjhbQo8RZ5LhWWaxmel1hFXLsuEJUwC+j0KmTWdiWuXqE45hQR+jhO8
vJlDzLTMb/tOJojL/Ud4LWKUHD5t6KJIQatner7L5qKlJlTBMkswV6dU3a2S
YjSTkqkS8TCcazqf0e4Esh+SeJESHEj4i1+eIYTJMzwvzV4Ma5dBDze1BP7X
vR4ZtvFge9tNIdkmhbVu0qdwzBncne5prXQh2pdNW/M+EGDn3EXxaldEpLeW
+8cJcDqpda1vrQix+QNG4ZQzHqjudewVzkfC3upOdSOBn3KD3SJLFIicr0//
upPAWc2W6pFXYtg3Lgl56OuKyBG+7pyNGIJPYZk6thPK5Ava5u+RY0idSJMX
iHG168a/JpYLyInlZo3KBckjLUfbb0qhYo9amplO6K0P8ldlK+CqoIdEl4iQ
9+PEFwdmfpktwx7rghUwn8gaYDVRcD9qdOu1ZgH4QYb40QUShPS/Xlr05YQy
ayxga8EWAd4e8iUxtBKs+kjmHb1CQ1b0IuPqRg5cr9rYTzURYOyoPc4ykLG+
oSl8+04WPhjyHlMviMHbdMno8YqPW2p1ReXgPHw1UiTQf6Sgp+14fWE6H2VR
nS/vWsyCfqMxIP4BFR7FF4vLpLOQokn6RvxuSvl5nTIjoYiF4PrgymPebCwl
DXXE/yKA8x3RuLuAD5J8ad6i7E/Kyo7dixOLOWjuWlMTYRbA0uSoG2+zwAdv
QvQtRYx7yf5rLMMIxMrW9EbtYMEzyc+66qEYv+ZPPrp1zQHkcHqtsMcOnBUr
3YoKHFBnTBmmFxF4E7PjTI2XI2ZXJKdSpgkER5bZDtVIYfVHteaGlINc29/3
vZ8rhvax+4vJKgVOdssD/YOcIJrYF/FEJoOmo9Quu3oBulKfZsfMEuH5dOWZ
9gsu6CX63h8pVYDIehS7ZISGGl/tw4D1QuyPYTU/o8twonwy3Wr4jXJE2abq
K+ahMzT3NCNajKah5cO/VdhCpjJOZ1E5iHNx5lOZYhzzUpjCT5LQVxF2LKPE
Fq29x8dSQwn8D14J2II=
"], "Angstroms", {{1}, {2}}}]], 
    StereochemistryElements -> {
Affiliation[
      "StereoType" -> "Tetrahedral", "ChiralCenter" -> 11, 
       "Direction" -> "Counterclockwise"], 
Affiliation[
      "StereoType" -> "Tetrahedral", "ChiralCenter" -> 13, 
       "Direction" -> "Counterclockwise"], 
Affiliation[
      "StereoType" -> "Tetrahedral", "ChiralCenter" -> 28, 
       "Direction" -> "Clockwise"], 
Affiliation[
      "StereoType" -> "Tetrahedral", "ChiralCenter" -> 30, 
       "Direction" -> "Clockwise"]}}], mcs], mcs]

Given our power in chemistry and in machine studying, we’re now in an attention-grabbing place to carry these fields collectively. And in Model 12.3 we have now the beginnings of built-in chemical machine studying. Listed here are samples of two courses of chemical substances:

&#10005

acids = {Molecule[{
    "S", "O", "O", "C", "C", "C", "C", "C", "C", "C", "B", "H", "H", 
     "H", "H", "H", "H", "H", "H", "H"}, {
Bond[{1, 5}, "Single"], 
Bond[{1, 10}, "Single"], 
Bond[{2, 11}, "Single"], 
Bond[{2, 19}, "Single"], 
Bond[{3, 11}, "Single"], 
Bond[{3, 20}, "Single"], 
Bond[{4, 6}, "Aromatic"], 
Bond[{4, 7}, "Aromatic"], 
Bond[{4, 11}, "Single"], 
Bond[{5, 6}, "Aromatic"], 
Bond[{5, 8}, "Aromatic"], 
Bond[{6, 12}, "Single"], 
Bond[{7, 9}, "Aromatic"], 
Bond[{7, 13}, "Single"], 
Bond[{8, 9}, "Aromatic"], 
Bond[{8, 14}, "Single"], 
Bond[{9, 15}, "Single"], 
Bond[{10, 16}, "Single"], 
Bond[{10, 17}, "Single"], 
Bond[{10, 18}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{20, 3}, {CompressedData["
1:eJwB8QEO/iFib1JlAgAAABQAAAADAAAAy+WqtmpOAUC0OlJvt4PxP9cVgoWt
lfS/h9BKaQDmD8DOBPTNy3Tov2n35zZnP+S/0NqgsP7pCsDj3TNLVWz6P4Pu
V5/CBt2/uFYfpon1978hvomBUvSxvyIA9rVBMaO/w9AGAEbU6z++t0VYNXfR
Pxd3axKxKNi/uiHIloWW3L92pdZmTkfhP8n8RNEWvOa/U3XfuugS9L/FKow2
L73uv/Ai+UwHdu8/x725Piuc8T9PorWGT9TjvxYteUZppuQ/GrVtulpeqj8n
YEuqa9bzv0HJ03r/RvU/ePKHx/piDkATKv01w1zkP/akrtsnUee/oXXNz2HC
B8DMgkHwTSHOP3OgvXTQu9q/G9emxOAt5b+zkeT+2cHzPw3P58WrHvi/+XSF
DJiCAMDfibMwREL3vwDApDNlcvg/X6+meObuAEDNBoEO83nqv7HHxOu57uw/
VxSVztsuzj+XsUBpHg3/v+XbSmRhEAFAccHkG82jDkDHM2Wgt6jCv+/VQo0a
BKA/6WOy8KIQEUCkJZ0HqsL4P7+tkWgpWtC/G1NhQS/5EUA21Mmw2ZnYP3y8
uyjsNvm/x3tMaXgrDcBpqdjxfur5v56R1Jz6Je6/0iEKSlhECMD5k62H4FoA
QHy0f4hhetk/zTQJLw==
"], "Angstroms", {{1}, {2}}}]], 
     AtomDiagramCoordinates -> CompressedData["
1:eJxTTMoPSmViYGAQAWIQDQUO3zRi+g99/bHf93NfcEmKkAPX9cUFtlz/7RU3
FGVMfMsG51eZrbYLv83roAlSrnEHLg/R/2E/jL9DrvV14I51cPNgfJh+dPtg
+mHuqRZZ5/6wiuUATD3E/u/2y1946P1fyOQAUXbBHizeJQLnw9QX2oJkGA/A
5N8Eglzwdb8oyFiRb/Yw82H2QdRzHoC4gwVuP8x9UL4DzH8wPgAJz4iI
"]}], 
   Molecule[{
    "O", "O", "O", "C", "C", "C", "C", "C", "C", "C", "C", "C", "B", 
     "H", "H", "H", "H", "H", "H", "H", "H", "H", "H", "H", "H", 
     "H"}, {
Bond[{1, 4}, "Single"], 
Bond[{1, 6}, "Single"], 
Bond[{2, 13}, "Single"], 
Bond[{2, 25}, "Single"], 
Bond[{3, 13}, "Single"], 
Bond[{3, 26}, "Single"], 
Bond[{4, 5}, "Single"], 
Bond[{4, 14}, "Single"], 
Bond[{4, 15}, "Single"], 
Bond[{5, 8}, "Single"], 
Bond[{5, 16}, "Single"], 
Bond[{5, 17}, "Single"], 
Bond[{6, 7}, "Aromatic"], 
Bond[{6, 9}, "Aromatic"], 
Bond[{7, 10}, "Aromatic"], 
Bond[{7, 13}, "Single"], 
Bond[{8, 18}, "Single"], 
Bond[{8, 19}, "Single"], 
Bond[{8, 20}, "Single"], 
Bond[{9, 11}, "Aromatic"], 
Bond[{9, 21}, "Single"], 
Bond[{10, 12}, "Aromatic"], 
Bond[{10, 22}, "Single"], 
Bond[{11, 12}, "Aromatic"], 
Bond[{11, 23}, "Single"], 
Bond[{12, 24}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{26, 3}, {CompressedData["
1:eJwBgQJ+/SFib1JlAgAAABoAAAADAAAA2xIKYANw5T9QcdP1A+7LP2Gge91g
l7M/nv27q156778e1ic1qDkFQL5rfumAGci/8yT2xXsMBcABhPidLL4AQGwN
Fm0HiP+/2wkJ0pG8/D9jDsThuw3cv7XuiTAkQOM/0j0+Y4kXCECaNzXwu3Hd
P2ysm12vzeQ/dFStAJWy4L91yrgpTfTev0H557/BfZ2/8sREc32B+r8UnJvo
4GXBP3fpKUo4a+G/Y7trT3guC0AuLfu376vuP9X6jsIJOOe/w5Xd2Vrm5L+k
oxwl4L/8vzjRDmkw6tY/qWUbA7jJBsBt6ds/eDviv2HKy/NFwOS/o8tZgvpv
/b9pX8mxNe0DwI6SETLLGdA/9WPuvJivB8CVAni0iub9vwtS8iM6stC/vFfA
uLDO+b9eiB8rzvH5P16nRWPfLfC/XoUSZXSM/z8+HqCb9On1v1IjRqt1E6o/
EOsxk/Ea+T8IVJhzipbmv8c2eRvjmPo/0ipdjWAuD0DwwqZ4sXmwvzHZFcH3
7/A/R5C047hYBkBBbCplOZ70P8wIRyWjufU/9wwH2+QJBUBMSdZTJgnnP/4J
jjL47Pe/J9COrh6mEUBpsJvxYwjjP2ws3BZWj/C/SWiZk6bsC0AN/mrB1H4A
QPzEY9KryOS/4eNaqmAuyD+f+IwUubACwDu0XZ1Rheg/ccLo6qStDcBzCiLX
seqfv6xNfYwL/fC/6MxVkJ2L/r8DJHOe4A0MwI84obVD6uE/db+y04MaD8A5
F7WbfiUDwE/LbKtLYta/QzNtuVGd9L+/AnoZqfEEQP5HJ+EDNug/F5wK1XGZ
CsBD42W3tw4FQOXYzMmWQvi/hvFLbw==
"], "Angstroms", {{1}, {2}}}]], 
     AtomDiagramCoordinates -> CompressedData["
1:eJxTTMoPSmViYGCQAmIQ7fu5L7gkRchhh1zr68Ad6/bPfia7/MUJGQeu64sL
bLm+28d5n2C3vS0K51eZrbYLv83r8CYQpOPhfsUNRRkT37LB9cPUw+TzFjPu
YQ2ShMszQABcHqb+m0ZM/6GvP+D2o+uvFlnn/rCK4QBMHqYeJi8KkhZ5Zx+3
y5OHaTWXg5xYFtBrH/brgxS0CsD5djpXZj2T5XI4I3B8147eW/a2II/tZYbz
IfYwObzcvp75ec/H/byFa7pvZ3y3B3v/+uv9kHD4bT+vQe1Q2/Lp+xemb35V
vFUY6t6/+yNPGR3Z+E7OAeLNC3D3FYItYj0Ak4eph/kH6j8HWHjA+AD39scp

"]}], Molecule[{
    "F", "O", "O", "O", "C", "C", "C", "C", "C", "C", "C", "C", "C", 
     "C", "B", "H", "H", "H", "H", "H", "H", "H", "H", "H", "H", "H", 
     "H", "H", "H"}, {
Bond[{1, 10}, "Single"], 
Bond[{2, 7}, "Single"], 
Bond[{2, 9}, "Single"], 
Bond[{3, 15}, "Single"], 
Bond[{3, 28}, "Single"], 
Bond[{4, 15}, "Single"], 
Bond[{4, 29}, "Single"], 
Bond[{5, 6}, "Single"], 
Bond[{5, 7}, "Single"], 
Bond[{5, 16}, "Single"], 
Bond[{5, 17}, "Single"], 
Bond[{6, 8}, "Single"], 
Bond[{6, 18}, "Single"], 
Bond[{6, 19}, "Single"], 
Bond[{7, 20}, "Single"], 
Bond[{7, 21}, "Single"], 
Bond[{8, 22}, "Single"], 
Bond[{8, 23}, "Single"], 
Bond[{8, 24}, "Single"], 
Bond[{9, 10}, "Aromatic"], 
Bond[{9, 11}, "Aromatic"], 
Bond[{10, 13}, "Aromatic"], 
Bond[{11, 14}, "Aromatic"], 
Bond[{11, 25}, "Single"], 
Bond[{12, 13}, "Aromatic"], 
Bond[{12, 14}, "Aromatic"], 
Bond[{12, 15}, "Single"], 
Bond[{13, 26}, "Single"], 
Bond[{14, 27}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{29, 3}, {CompressedData["
1:eJwByQI2/SFib1JlAgAAAB0AAAADAAAAUQZRdcCD8j86RJqTdcUFQLHjE4X5
X+y/R5dE04Ht5L9VnskO53PqP86kzYH/58y/soZH0CSvF0CaaBJ9p9npP8ig
KCVNgMU/M3+Bp9DUFUAxAhOwZ+P5v8qC91I7Mse/KDdYtvjAB8D+IYqY6wfa
P0yYsu2klKW/46N5fbyiD8D4thNxHi3mv8SQnOc9w9U/hwoQhHdc+b93FIPJ
gG7Gv/Wx6QBpgr8/J7+JyzR4FcCRRzl4d5HDv/49ME2yNcg/FT43jDII5j+4
1EOD7J3hP2/DV6w7k8S/LO+O0NHI+T/zo8QH3E/4P9adr9/J6d+/P+Ah3oLW
8T8e+zt0Jxrmv7xFiHnC084/QJrmP9dJC0CpbT0BqNOgPxyggFm93qW/49bA
7pnJB0A+Xy/iYlf0P9yQctHMXNy/1wUpWNzoA0AH2eBG5tntv0Kl9wiM0tI/
+qryeXW7E0BjCEeTGAbRv5qJe8e7C5s/YbjS7O75CMDOGFG4XavzP5WqDXRN
jeU/Xh2p72b9CMB8yUxVK4boP/AkfyhX+PC/sGYXAB9yDsAoF7BcDsPtv2Or
y3H6mfY//OA+B11HDsA8eKc3OVf5vy+kMmyaw9G/LrPpSJ2I97/sy0KKS1vc
v5N297TYaPM/p3KXLz8R97/RpShPzPvwv6NsofOj/t+/Z3E6kPigFcAhexvW
54bsP+6iTE9y8eE/xAgd16SLFsDfa7AMjGvGv3ucBt0X8+y/Y+B+97JZGMDY
3yebLWnqvy8y6q3nV+Y/w7oYJK5s3T8S/HwuaLj3v5/MPccfe+A/J9f6WtSh
DUCSeXt2ARcAQAckr+5tdOa/6OnJpUCMBkBqKMYoGa3+v9JnQ8y9m+M/7eD3
N33DFUCnvFZrbyD6P+PZfNb86t8/Ed13BV7rGEAHRt0zbYj7v2O1va8xndo/
OEh46g==
"], "Angstroms", {{1}, {2}}}]], 
     AtomDiagramCoordinates -> CompressedData["
1:eJxTTMoPSmViYGCQBWIQDQUOO+RaXwfuWLe/ymy1XfhtXodvGjH9h75+2O/7
uS+4JEXIASQr18rtoLihKGPiWzY4HyZfLbLO/WEVy4E47xPstrdFoXyOAzB5
iHk/9sPkbbmuLy6wFTgAsw9mP8x8TZByjTv2MP0wPkw9WDvXf3uYegj/O1w9
jA9TD3Evu0N6GhA843dYdyO+zH8e8wFVtsapzt2CDnfcmCu4VTgPAAmNOh8J
B4+APxLF4ZwH2i2uHc3dIuYg+ShCfPtF5gMZm18Vb70q4jBhwQ/DZ+t+7Y/6
uvNWl62wQ3pHcuwdt/f7H5tJHYhOEIb7D+ZfiP+EDtwCWisXJgGXB1NdIg5L
CkAiB+yXv/DQ+7+QyQESLX/sYfIwPsx/UP3w+IDxAbOMxbo=
"]}], 
   Molecule[{
    "O", "O", "O", "C", "C", "C", "C", "C", "C", "B", "H", "H", "H", 
     "H", "H", "H", "H"}, {
Bond[{1, 7}, "Single"], 
Bond[{1, 15}, "Single"], 
Bond[{2, 10}, "Single"], 
Bond[{2, 16}, "Single"], 
Bond[{3, 10}, "Single"], 
Bond[{3, 17}, "Single"], 
Bond[{4, 5}, "Aromatic"], 
Bond[{4, 6}, "Aromatic"], 
Bond[{4, 10}, "Single"], 
Bond[{5, 8}, "Aromatic"], 
Bond[{5, 11}, "Single"], 
Bond[{6, 9}, "Aromatic"], 
Bond[{6, 12}, "Single"], 
Bond[{7, 8}, "Aromatic"], 
Bond[{7, 9}, "Aromatic"], 
Bond[{8, 13}, "Single"], 
Bond[{9, 14}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{17, 3}, {CompressedData["
1:eJwBqQFW/iFib1JlAgAAABEAAAADAAAA84DbLJLgC8AJzyREqwbAvwm+SJav
s8o/Mo9q1PepB0CeH3Peq+rrv3zIJIgchvC/jrBMxDO+B0BXsLU/ZfThP2Il
WquPAvA/amFiEHep5T/d3OBU6hNiP7EciujmGqe/jQ25Y1jniD+XTeQTHbPy
vzG4o8x5cM4/l9bw7kn4rb+IvOay64XyPzbMEPWkzc+/Vxtf1aDrAMBMqo/d
uSWov47m08YpFL4/M4HteP7W9b9KcnWg+xHzv9ZFQPVUVtQ/B70Q6VP09r8A
zpmpJ+bxPyhR0Xf7JcW/5+imIYLrAUDnakbMwDmxP36aV2uXcMK/eZuTTLVt
4j/HofpeocsAwLFeLdpfzdk/xRaniYe93T8CwDzBO50AQC6VRRdYHt6/nsFl
dE3p/b+n5JK45AIBwNWNtRNSWeE/GgLkB7IEAMCVhf8H9TEAQCk0jDZjztS/
PyC0K4F9EMCKJF4r36vUv90ZWyPc7+C/KrVYNvYMD0CPln1BTEfgvygWcZhI
y/K/GqnnIhFnBUCTA/Nkzkb3Py5DKIby6/Q/7LDXOA==
"], "Angstroms", {{1}, {
         2}}}]], 
     AtomDiagramCoordinates -> {{2.866, -2.405}, {3.7321, 2.095}, {2.,
       2.095}, {2.866, 0.595}, {3.7321, 0.095}, {2., 0.095}, {
      2.866, -1.405}, {3.7321, -0.905}, {2., -0.905}, {2.866, 
      1.595}, {4.269, 0.405}, {1.4631, 0.405}, {4.269, -1.215}, {
      1.4631, -1.215}, {2.3291, -2.715}, {3.7321, 2.715}, {2., 
      2.715}}}], 
   Molecule[{
    "O", "O", "O", "O", "C", "C", "C", "C", "C", "C", "C", "C", "B", 
     "H", "H", "H", "H", "H", "H", "H", "H", "H", "H", "H"}, {
Bond[{1, 5}, "Single"], 
Bond[{1, 11}, "Single"], 
Bond[{2, 6}, "Single"], 
Bond[{2, 12}, "Single"], 
Bond[{3, 13}, "Single"], 
Bond[{3, 23}, "Single"], 
Bond[{4, 13}, "Single"], 
Bond[{4, 24}, "Single"], 
Bond[{5, 6}, "Aromatic"], 
Bond[{5, 8}, "Aromatic"], 
Bond[{6, 9}, "Aromatic"], 
Bond[{7, 8}, "Aromatic"], 
Bond[{7, 10}, "Aromatic"], 
Bond[{7, 13}, "Single"], 
Bond[{8, 14}, "Single"], 
Bond[{9, 10}, "Aromatic"], 
Bond[{9, 15}, "Single"], 
Bond[{10, 16}, "Single"], 
Bond[{11, 17}, "Single"], 
Bond[{11, 18}, "Single"], 
Bond[{11, 19}, "Single"], 
Bond[{12, 20}, "Single"], 
Bond[{12, 21}, "Single"], 
Bond[{12, 22}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{24, 3}, {CompressedData["
1:eJwBUQKu/SFib1JlAgAAABgAAAADAAAA25cgDbc0/T9e3zJoFjD2PzJ8J7OL
y+s/QCbdeNZ3A0DKFAot3Uzyv2cHB1zqm6c/jXUu3K8VDcBwpmKHUHPdP3Nx
pOVVQ/q/8i3G2+bcDMDyFc3TVDTxP61p/hNeIek/cxh3VRQf6j+MGEpQVoDi
Px7wHnS4m9Q/k/sylbap8T/sgAK9Levmv0kUEFCHr7q/mDPocBDi9r9sdGVD
VyLRP36fi+eG4dS/tUv65PAy3b+jLbtPAiDxPxbxuIMH2so/oW1KzC6GwT/W
s0pCpI34v5WnkzQkoeS/e3t7vtSC8r94d3UCRTPwv8MWvZ0uBOi/FeILcs9t
+D9DPrT1WnIFQN4gHyz+rPQ/uKqrxycFBkDbpYYLsaIDwJrW7906QNi/44HV
B736BsBsbsbkhobqP8cMWMpn8Ny/5JLffLcS5r81HVJ54ZIAQL8LheCrLuE/
UGQsbmBz2D9fNiaHt0gEwLVnUh9mAe+/lYw69Mqn/r/HOnX1Mp/6v0MVfXqv
2fK/qbcMfeT48z/e3pBwM1MKQLEgiq99ktk/GNkAoNqU5D96Q6Ea0cYFQIFr
zPXDzP8/sjdKUmUoA0ANLeKUjRcJQJbPWpL/zvw/lGjRbzkBA0Ctt0AEOqsE
wJr/LA95sva/xDHIASVxAkDQJU0JmdoJwBqt8j+GrtA/KZfEnIrjDkAbNAet
hGQEwIdxOPknptW/WgkBU+29EMB6h0CQ0UbWv+exVApv8ve/Wv1crhXXDsD6
rE9pECfKPzuwXuV6CPM/pjEkiw==
"], "Angstroms", {{1}, {2}}}]], 
     AtomDiagramCoordinates -> CompressedData["
1:eJxTTMoPSmViYGCQAGIQrbihKGPiWzaHbxox/Ye+ftnv+7kvuCRFyKFaZJ37
wyqmA3HeJ9htb4s6tL4O3CHXyuhQZbbaLvw2Lwb/DYj7+iVcP7p5oiDjRJ7Z
w9QHgZQHnrCHmQ/TD+PD5BkgAEMe4j62AzDzua4vLrDl+m1/YsbuaRP6OR0g
2h7YS+vfVWFjlIDq/7gfxofJQ/3pwJWhlFNRdXE/b+Ga7tsZ36H2PtgPM/fl
9vXMz3u+7ldw/Jh8Zq6Iw9fb1xuLj3EdgJkH8S/Hgdmh81evlRB3YPRt4fXX
R4Qf1L3w8ILxAbE4o54=
"]}], 
   Molecule[{
    "S", "O", "O", "C", "C", "C", "C", "C", "C", "C", "C", "B", "H", 
     "H", "H", "H", "H", "H", "H"}, {
Bond[{1, 5}, "Aromatic"], 
Bond[{1, 7}, "Aromatic"], 
Bond[{2, 12}, "Single"], 
Bond[{2, 18}, "Single"], 
Bond[{3, 12}, "Single"], 
Bond[{3, 19}, "Single"], 
Bond[{4, 5}, "Aromatic"], 
Bond[{4, 6}, "Aromatic"], 
Bond[{4, 8}, "Aromatic"], 
Bond[{5, 9}, "Aromatic"], 
Bond[{6, 7}, "Aromatic"], 
Bond[{6, 13}, "Single"], 
Bond[{7, 12}, "Single"], 
Bond[{8, 10}, "Aromatic"], 
Bond[{8, 14}, "Single"], 
Bond[{9, 11}, "Aromatic"], 
Bond[{9, 15}, "Single"], 
Bond[{10, 11}, "Aromatic"], 
Bond[{10, 16}, "Single"], 
Bond[{11, 17}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{19, 3}, {CompressedData["
1:eJwB2QEm/iFib1JlAgAAABMAAAADAAAAzlvqhoOz6j+P01Ss6YT3vxo1/03f
KNk/kxrosAk3EEBjTFU28Gn0v4NrWzYLXta/0ThZT32GD0CkHd250ljzP0Pz
1XJW8ti/723JIfOg4b++IBaxl4rWP1tCt3P7Wdi/6HS1G17L57/oNGQKrfrq
v93qz6t2nNA/zO68EUTh5j8zNlMT+qvlPwAExwQ7a+a/5CzxCSs2+z/svq9Y
RfzKvz5pd5SJGde/NRRkgA2m+78TgoEipHbxP3m8QMSX2eO/5SlkPafj/78a
1GZbkwD1vwdkOAw63+Q/r3HDtyi3B8BEPjwd4MXkP7rtom9wIs+/nAKUrZoZ
CcA3EuVfacDhv4mHld0Xh9k/gB1585IHCkAvxG6vG6qwvxRhAU0O8OO/kqHM
rk3h7z9u3MngEP/5P5pcFGghk/O/19y4RyAX+7/BO1OjDWQAQPYblhG75fG/
1qUXy3h4AMBFeW5kaicCwGnZIr8EdvI/dwhWH6/IDsBlDFtoBGf0P54TXWa9
b92/4Lz9gFtzEMCguAVoVUXsvz+S7SPE8uU/X4nCNtM8EEAl3Bq3Zu/9v1Zh
0r/+PvK/HLTjOrw1CkAs5IWczj79P5GJhEeNAlU/ToLtzQ==
"], "Angstroms", {{
         1}, {2}}}]], AtomDiagramCoordinates -> CompressedData["
1:eJxTTMoPSmViYGAQBmIQfaOx2G3KNiEHmdePzKQOvLRX9qpu1ueRdmg+cGqh
67bX+9H49lVmq+3Cb/M6MIDBg/1ofHs086D6RaHyDAyKG4oyJr5lg/I/7Efj
20OVwc1H40PdJwk3rzJihenZamEHEGXt9w1u3pvAHXKtr3+i8+15C9d03874
bg/hv9yPxrefF6d5WqBdFu5/NL49AIFXdGY=
"]}], 
   Molecule[{
    "C", "C", "C", "C", "B", "O", "O", "C", "H", "H", "H", "H", "H", 
     "H", "H", "H", "H", "H", "H"}, {
Bond[{1, 2}, "Single"], 
Bond[{2, 3}, "Double"], 
Bond[{3, 4}, "Single"], 
Bond[{3, 5}, "Single"], 
Bond[{5, 6}, "Single"], 
Bond[{5, 7}, "Single"], 
Bond[{2, 8}, "Single"], 
Bond[{1, 9}, "Single"], 
Bond[{1, 10}, "Single"], 
Bond[{1, 11}, "Single"], 
Bond[{4, 12}, "Single"], 
Bond[{4, 13}, "Single"], 
Bond[{4, 14}, "Single"], 
Bond[{6, 15}, "Single"], 
Bond[{7, 16}, "Single"], 
Bond[{8, 17}, "Single"], 
Bond[{8, 18}, "Single"], 
Bond[{8, 19}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{19, 3}, {CompressedData["
1:eJwB2QEm/iFib1JlAgAAABMAAAADAAAA+paJWSCX+b+hz7gouhH3PyesOv6B
rL+/XkXeBFyC7L80XKzDIpLBPyOyZmdPLs6/thbdVayh0z+sYHICfe+ZP3CW
jgN++dM/SZC6o1I+7T8sGIlzat7yPyLJaVamQvA/WaM0d4A98T+3tQlE3zr1
v+27hEQgXss/d3zgnnJ1AEB1FUUgBe75v1UrpvP8FfQ/CVx7TKAq9T/kWG+2
Wrj9v1Ac4KjsEvK/LLEya3a9979VH+6YlIPwv0cSonpWB+6/upYQzKaoBMA4
cn1c2+r2P3aUTkUoH+O/t3PHcmaW+r+oe2KG3tn8P8rDkRuxWu0/Axl4cAUY
77+2nbzF1oIBQDFw8iaxBua/557Yoir07j8VJ4lK2wHtP7Dh79kAvgBAFkJZ
dw4l/z/6SGK06VD1PwcYtZkLSuM/iUpIjEWe1z/EcgLkEeAAQB4Ay/KSHes/
xWiFal/zBkAgUFkCc+Dwv8RJFkLt6/I/iEPA0jQuAkDEGqBB3tT8v68lJvPl
L/a/NfMVrxL99b9MCcpubKb+vyiv+u8crNG/FrVCxtZgBMB+Urfj0P7ov5WV
p6GeZPK/tRl6kni4778Lx3qgj6byvxCdlCM7ov6/qc3vAw==
"], "Angstroms", {{
         1}, {2}}}]], AtomDiagramCoordinates -> CompressedData["
1:eJwBQQG+/iFib1JlAgAAABMAAAACAAAA+wzZ0Kr6AkA4tdB5ch3Bv83AvZ9R
oO0/RgDoaZ354L8w7irIoQ7Cvz7P1Xv2w+A/4+xMf9yKzj/buIOW5Zn/P1aX
2AoBZ/m/HvGHwdZGwD/Aat4JfzwFwOXlD8uk5/I/upLH0zB6/78Y02eADy/1
vwjK3w3yeeE/YNGMDbm0/78RLEtVqYMLQGj+GEJ4AvO/MBUVB63EDECH029+
73vnP8wjylwAsPs/NEkb9kaN8z8s17xhiPb6PyzRHv6C+QJAyET/hg9duT+p
enGyoL8LQBChKshPGvS/zliVP6fGAEDEA2S5imcQwNb4q8oIHek/JGbN0q5P
C8CQvCHmL4j7vzEj1A/2zvk/kNw1gMFJCMDujfEwdKXTvzycHbUiuQnAXqkD
+isl6r9PlZ9NA7H1v8DJopM=
"]}], 
   Molecule[{
    "O", "O", "O", "N", "C", "C", "C", "C", "C", "C", "C", "C", "C", 
     "C", "C", "B", "B", "B", "H", "H", "H", "H", "H", "H", "H", "H", 
     "H", "H", "H", "H", "H", "H"}, {
Bond[{1, 16}, "Single"], 
Bond[{1, 17}, "Single"], 
Bond[{2, 16}, "Single"], 
Bond[{2, 18}, "Single"], 
Bond[{3, 17}, "Single"], 
Bond[{3, 18}, "Single"], 
Bond[{4, 11}, "Aromatic"], 
Bond[{4, 12}, "Aromatic"], 
Bond[{5, 13}, "Double"], 
Bond[{5, 16}, "Single"], 
Bond[{5, 19}, "Single"], 
Bond[{6, 14}, "Double"], 
Bond[{6, 17}, "Single"], 
Bond[{6, 20}, "Single"], 
Bond[{7, 15}, "Double"], 
Bond[{7, 18}, "Single"], 
Bond[{7, 21}, "Single"], 
Bond[{8, 9}, "Aromatic"], 
Bond[{8, 10}, "Aromatic"], 
Bond[{8, 22}, "Single"], 
Bond[{9, 11}, "Aromatic"], 
Bond[{9, 23}, "Single"], 
Bond[{10, 12}, "Aromatic"], 
Bond[{10, 24}, "Single"], 
Bond[{11, 25}, "Single"], 
Bond[{12, 26}, "Single"], 
Bond[{13, 27}, "Single"], 
Bond[{13, 28}, "Single"], 
Bond[{14, 29}, "Single"], 
Bond[{14, 30}, "Single"], 
Bond[{15, 31}, "Single"], 
Bond[{15, 32}, "Single"]}, {AtomDiagramCoordinates -> CompressedData["

1:eJxTTMoPSmViYGBQAGIQ/eXvlYqXakwO1SLr3B9WCTiIgigRTodvGjH9h76y
OCyffURhQ9E3exifJYxPd9NcVocdcq2vA3fIOkjr31VhYxSA638uu/yFh95D
exgfZv6bQJCOj/Yw/SDTNO4oOaiyNU517uaB8hUdjnubdzom/LWH8WHyO8H2
ycPlYXz3op/8L8uFoe7lQbNfBO7+64sLbLmuP7ZH9R8Pmv944O6F8Bng/oPw
hRwYoABiPp9D7tF/m6qL2KD+ewn336yZQCCpAhHPhoWPkkOyQITllhNf7GF8
VHk5NHk5uP8gtnJAw1/UoRDom8UF/HD3QOJD1CHilNGRjXof7WF8mP9g6poP
nFrouu21/eGvIA+9tQcAXrPZ1Q==
"]}], 
   Molecule[{
    "O", "O", "O", "C", "C", "C", "C", "C", "C", "B", "H", "H", "H", 
     "H", "H", "H", "H"}, {
Bond[{1, 7}, "Single"], 
Bond[{1, 15}, "Single"], 
Bond[{2, 10}, "Single"], 
Bond[{2, 16}, "Single"], 
Bond[{3, 10}, "Single"], 
Bond[{3, 17}, "Single"], 
Bond[{4, 5}, "Aromatic"], 
Bond[{4, 6}, "Aromatic"], 
Bond[{4, 10}, "Single"], 
Bond[{5, 7}, "Aromatic"], 
Bond[{5, 11}, "Single"], 
Bond[{6, 8}, "Aromatic"], 
Bond[{6, 12}, "Single"], 
Bond[{7, 9}, "Aromatic"], 
Bond[{8, 9}, "Aromatic"], 
Bond[{8, 13}, "Single"], 
Bond[{9, 14}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{17, 3}, {CompressedData["
1:eJwBqQFW/iFib1JlAgAAABEAAAADAAAAerD5FqXzBMDuCn1EKQD6v3Y5KpkZ
dtu/TAnvY2bbCEBy2X+TbNvjP6E9K4ctmOa/Q7FmMrWIBUCD/1hpZA/xv+Vu
wAg+NPE/x4OlVA175D/qCcg+Wg6IP3PnQA4Rore/vDPpJboJ1b8loeVpFW3u
vyCXgs4/G9G/7FyzlXT+zD9l2Lo5hPz0Pz5DXsfYIbo/lUTPcNXL+r96Rf/u
xOPjv4z5BnIDx8+/ol/x3VLY8b8SCix9Gxz6PyoNQJtbqr4/30Z0viTOAMCR
3/ZzU6rlP1i+Qkh616u/T86UzBldAUDafVYinP/Wv4c/vQcRDb2/mQjYZTCQ
kT/DSFM4Smn/vwnsOvxWwtq/RV6uCtGS7z/xmcy3pJ8AQKXn8Lyk3M4/yJfH
dwd697/bZDK3JzUFQCWh9hBmYNE/Z1w47nAxCcBeIIdyBhnuP/pntkicsaO/
qkybe7erB8DKXrQNk9IAwERsf2FzYtk/Y6I36E7pDEAOOMlhV3vMP2dNu74K
E/e/h7ZJtHtc/z/WXwA80Ur3vxpyTZzcpvk/Lb/Rbg==
"], "Angstroms", {{1}, {
         2}}}]], 
     AtomDiagramCoordinates -> {{2., -1.75}, {4.5981, 1.75}, {2.866, 
      1.75}, {3.7321, 0.25}, {2.866, -0.25}, {4.5981, -0.25}, {
      2.866, -1.25}, {4.5981, -1.25}, {3.7321, -1.75}, {3.7321, 
      1.25}, {2.3291, 0.06}, {5.135, 0.06}, {5.135, -1.56}, {
      3.7321, -2.37}, {2., -2.37}, {4.5981, 2.37}, {2.866, 2.37}}}], 
   Molecule[{
    "O", "O", "O", "N", "C", "C", "C", "C", "C", "C", "B", "H", "H", 
     "H", "H", "H", "H", "H", "H"}, {
Bond[{1, 8}, "Single"], 
Bond[{1, 10}, "Single"], 
Bond[{2, 11}, "Single"], 
Bond[{2, 18}, "Single"], 
Bond[{3, 11}, "Single"], 
Bond[{3, 19}, "Single"], 
Bond[{4, 8}, "Aromatic"], 
Bond[{4, 9}, "Aromatic"], 
Bond[{5, 6}, "Aromatic"], 
Bond[{5, 9}, "Aromatic"], 
Bond[{5, 11}, "Single"], 
Bond[{6, 7}, "Aromatic"], 
Bond[{6, 12}, "Single"], 
Bond[{7, 8}, "Aromatic"], 
Bond[{7, 13}, "Single"], 
Bond[{9, 14}, "Single"], 
Bond[{10, 15}, "Single"], 
Bond[{10, 16}, "Single"], 
Bond[{10, 17}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{19, 3}, {CompressedData["
1:eJwB2QEm/iFib1JlAgAAABMAAAADAAAAFzLam0pYBcBRa8uKyk/kPyCIQKbD
5fA/mtqEm1GKB0AAlOvRf3r1v/sqTOnOafu/rdVEFYebDUBagfaIPrPlPwm1
9wqBU9q/XYbOq8Yj8b8X2xGMe0nZv1ql6esiCtu/bUMJSXLz8z8qOWIWsh6u
v6w5ua6nJci/mRdwxHpt8D9+h3ZOjEToPx7MjMT+kew/HiqEZsxr0b9cEYv0
exPvPx4PA4kxiPQ/sm/8aoGz9b9K8JG6+DfZPzTUrdxmGuQ/dcrKhW5Wxz8Z
4QjJB2/kv6T5zkqKKeu/v94EH9ajDcAxXp+1g9x4Pzo92OY8HdU/WmOHnTCQ
BUCI5AIY0qTVv9zX+Mnnt+W/LGowgIP8/T8r5TeTxCTzP2hMHTcINfY/oVnj
W47p37/nyS6cubD5P7cyOCzPBQFATDygDqxd1z/Nn8m/+a/0v7XbBpZxcvu/
M2VBsv9WEMDPiWG3X6fnP6QOFO1iQdq/jITbYkEUC8Aj2QCOqPftv16sy3q6
ysK/BL7at4QgEsB1NPi0AIzNv7oPnE2Os/A//z0MUrQZCkB9uWKnyY4BwP42
a4wLtfS/wy8hAhQbEUDqIA7Ocm/cPxJah/mtkdc/p2Ht7Q==
"], "Angstroms", {{
         1}, {2}}}]], AtomDiagramCoordinates -> CompressedData["
1:eJxTTMoPSmViYGAQBmIQrbihKGPiWzaHapF17g+rfu2f/Ux2+YsTMg7XFxfY
cl0/vD9vMeMe1iBJh9bXgTvkWr/a+37uCy5JEYKrj/M+wW57WxSuHiYvCpIW
uWZfZbbaLvw2L1wexofo/wTXD+MzQACcD7MfZh7MfCAHKPLO/sSM3dMm9HPC
zLeX1r+rwsYo4VAI5C0u+L4fYg6TAz/31mWVxx/v5y1c030747s9F1jD6/0Q
+rc92B6h3/sjTxkd2fhODm6ee9FP/pfl0jD/2gMApr+NbA==
"]}], 
   Molecule[{
    "F", "F", "F", "O", "O", "O", "C", "C", "C", "C", "C", "C", "C", 
     "C", "C", "C", "C", "C", "C", "C", "B", "H", "H", "H", "H", "H", 
     "H", "H", "H", "H", "H", "H", "H"}, {
Bond[{1, 20}, "Single"], 
Bond[{2, 20}, "Single"], 
Bond[{3, 20}, "Single"], 
Bond[{4, 8}, "Single"], 
Bond[{4, 9}, "Single"], 
Bond[{5, 21}, "Single"], 
Bond[{5, 32}, "Single"], 
Bond[{6, 21}, "Single"], 
Bond[{6, 33}, "Single"], 
Bond[{7, 8}, "Single"], 
Bond[{7, 12}, "Aromatic"], 
Bond[{7, 13}, "Aromatic"], 
Bond[{8, 22}, "Single"], 
Bond[{8, 23}, "Single"], 
Bond[{9, 11}, "Aromatic"], 
Bond[{9, 15}, "Aromatic"], 
Bond[{10, 11}, "Aromatic"], 
Bond[{10, 18}, "Aromatic"], 
Bond[{10, 20}, "Single"], 
Bond[{11, 24}, "Single"], 
Bond[{12, 16}, "Aromatic"], 
Bond[{12, 25}, "Single"], 
Bond[{13, 17}, "Aromatic"], 
Bond[{13, 26}, "Single"], 
Bond[{14, 16}, "Aromatic"], 
Bond[{14, 17}, "Aromatic"], 
Bond[{14, 21}, "Single"], 
Bond[{15, 19}, "Aromatic"], 
Bond[{15, 27}, "Single"], 
Bond[{16, 28}, "Single"], 
Bond[{17, 29}, "Single"], 
Bond[{18, 19}, "Aromatic"], 
Bond[{18, 30}, "Single"], 
Bond[{19, 31}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{33, 3}, {CompressedData["
1:eJwBKQPW/CFib1JlAgAAACEAAAADAAAAGh8HgFsVGUDshpi01F7vv8rQTEHw
Ar0/7liGTyXrEkAXrymp1tHuv7UREcwVBPs/KZGr5Am4F0B69NcO9oLuPyeK
vkj9P/Q/2rajQu+d5D8VynMvTvbMPwXLYsRSuua/p0ogNvjCGcCY41eQbQ/T
vxqw1toZHPU/8VkoJ7kdGcDHQZ1ZvYauPwt/rEjU6vG/yuc3T/fE9b9tK9eS
DPHhvyLzfHvgMdQ/ooIlsAnAwD8g41oiuWrev3F1YDGVYNg/2wadHCm5/z9e
/Vm30VfcPwfGqlDYZeu/hPXLWtQzEUDO8nx3AybSPwT2HPTUR8y/m18bKZGl
B0Ds1gpjIMOWP2DEvun/hmq/ZEqreocIAMC7e68vGxH2v9jQduattuK/zQ+L
p3BGAcBKKNTqE7zLPz1JSvUdRPI//L2ylmavEMB2nHh86hjlv1fXo93Uo8I/
V/qyAYBWA0CKjWhqYqLyP0fqeUHirP+/fFTKACQOC8A4aEU74/X2v4WkvW8c
oeW/UDk1QxQ+DMDMOrAQIMbEP3eG6VOI1fA/IlYN6B7GEkBspJPTR6jvPz+C
Anx+M/W/V8HRWI7sDUDj4Z8Ox+v2P33CwepErQHAqO1L7XVFFUDImxGeT1HI
v2OfIaclSuc/IA7EVVQCF8CYZNqgOKPlv+oOlWNj668/gd2CYcwJ1j8WPOEC
ToKZPzea4vMPovU/noZlAaXt4T8yPcSLF8D3v3ZbHo3eStk/13iQOcAWBUBv
0f0qxIDhv8O1zdIuPuw/wUiMatx+9r8oxYPPUPn/v9RpTyCKuvO/F5JB6HLw
+r+Hd76zQ8DrP3uwpcqv1/0/3zW+6Vac+j/z6mldyEb4P/ths8pUgAXA/or3
iKZAD8CwTDOHUZ8AwD9JfdM4D/a/MKo5JHW7EMBMA1RN95LoP7Omb086Jfs/
Mz5OZ+MBF0CTD94gIDfzP6hfmvPHGfi/QaZ9BSA4EEAbvdHYCtD/P0xnBeG+
mgjAp1QJKs3pGMCFFJuQyd/kP9IEh6z1bPg/TylZFWuMFsCHzr6j+w/oP3fx
GoCpzva/GdGa3g==
"], "Angstroms", {{1}, {2}}}]], 
     AtomDiagramCoordinates -> CompressedData["
1:eJxTTMoPSmViYGBQBGIQbSJoZrPXSNnBjuv64gJbTgcIX9FBvvV14I55Ag4Z
SjkVValycHn3op/8L8ulHUA8ruuH7auOa1pN8mZxOPxVI6b/ENOBy75JAhGW
3FA+3wFp/bsqbIwSDiDj5Fq/7ofpBxvH9Xp/5CmjIxvfyTl8Ayn/+sQeZr8t
WAGjA0y+WmSd+8OqX/Zg4S4RuH6Y+TD7f9Vl7SkRFoTzYebB3AuTh7kHZh5E
PdsBm71B0xTfKcHtg/HR3QcLD1T/sh0ILVGZ/j9AxsEj4I9E8fVv+13BHpZ1
uPo8S/vb9Of7Zz+TXf7ihIxDIdiD/+H+OXsGDPZ//Xul4qWaFNR8Vrj7Iebf
3V9lttou/DavA9AxQIEPcPcDPQP0EfeBlUv8HIQZVeDmw/iiIO+IXLNngAC4
+YobijImvmWDxfcBAAWw57Q=
"]}], 
   Molecule[{
    "F", "F", "F", "O", "C", "C", "C", "B", "H", "H", "H", "H", "H", 
     "H", "H", "H"}, {
Bond[{1, 8}, "Single"], 
Bond[{2, 8}, "Single"], 
Bond[{3, 8}, "Single"], 
Bond[{4, 6}, "Single"], 
Bond[{4, 16}, "Single"], 
Bond[{5, 6}, "Single"], 
Bond[{5, 7}, "Single"], 
Bond[{5, 9}, "Single"], 
Bond[{5, 10}, "Single"], 
Bond[{6, 11}, "Single"], 
Bond[{6, 12}, "Single"], 
Bond[{7, 13}, "Single"], 
Bond[{7, 14}, "Single"], 
Bond[{7, 15}, "Single"]}, {
    AtomDiagramCoordinates -> {{2.702, 1.5}, {0.9699, 1.5}, {1.836, 
      0.}, {0.5369, 4.5369}, {2.269, 4.5369}, {1.4030000000000002`, 
      4.0369}, {3.1350000000000002`, 4.0369}, {1.836, 1.}, {2.6675, 
      5.0119}, {1.8705, 5.0119}, {1.0044, 3.562}, {1.8015, 3.562}, {
      2.825, 3.5}, {3.6719, 3.7269}, {3.4450000000000003`, 4.5739}, {
      0., 4.2269}}}], 
   Molecule[{
    "F", "O", "O", "O", "C", "C", "C", "C", "C", "C", "C", "C", "C", 
     "C", "C", "C", "C", "B", "H", "H", "H", "H", "H", "H", "H", "H", 
     "H", "H", "H", "H"}, {
Bond[{1, 8}, "Single"], 
Bond[{2, 6}, "Single"], 
Bond[{2, 7}, "Single"], 
Bond[{3, 18}, "Single"], 
Bond[{3, 29}, "Single"], 
Bond[{4, 18}, "Single"], 
Bond[{4, 30}, "Single"], 
Bond[{5, 6}, "Single"], 
Bond[{5, 8}, "Aromatic"], 
Bond[{5, 9}, "Aromatic"], 
Bond[{6, 19}, "Single"], 
Bond[{6, 20}, "Single"], 
Bond[{7, 10}, "Aromatic"], 
Bond[{7, 12}, "Aromatic"], 
Bond[{8, 15}, "Aromatic"], 
Bond[{9, 16}, "Aromatic"], 
Bond[{9, 21}, "Single"], 
Bond[{10, 11}, "Aromatic"], 
Bond[{10, 22}, "Single"], 
Bond[{11, 13}, "Aromatic"], 
Bond[{11, 18}, "Single"], 
Bond[{12, 14}, "Aromatic"], 
Bond[{12, 23}, "Single"], 
Bond[{13, 14}, "Aromatic"], 
Bond[{13, 24}, "Single"], 
Bond[{14, 25}, "Single"], 
Bond[{15, 17}, "Aromatic"], 
Bond[{15, 26}, "Single"], 
Bond[{16, 17}, "Aromatic"], 
Bond[{16, 27}, "Single"], 
Bond[{17, 28}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{30, 3}, {CompressedData["
1:eJwB4QIe/SFib1JlAgAAAB4AAAADAAAA/ngdzRDyD0DkFLtxMXvRvwoXrLxO
Kvw/jZRXL/6U0T+TDwynJRuWP/C79Vk89LK/qA0lJzkPEsDDKLss9LWhv1qM
4MIhiv+/m+VUmeM0F8BRXkotFFToP8r+rSDVMa8/hdgM15tOBUBx/qd8v9G1
P7NXDhF488S/Vtir9Duc9z/j5DpeYtS6v37liZNTmOU/MxMjKAQI778nu6Hc
gBq/v3TSwPrhweA/FcOogiw5D0C3Q0bWQsyEv8f5bBVzvts/9Z1JJ7NIBEBl
OA1UBr7WPzGEL3TSevi/nhdT/OgHAcChwnaNK/1Qv7oCif8Wgsi/2G3xsMgN
C8AayQZovw/BvxrqTQfieNY/tH31yOB28b/bglI9WDrZv0Fzhb20D/4/IDjt
3ULGC8DxqrVxd+jZv3KaP6d9Qfs/nEscncmUAsCkE+/SDkThv956ehEM6gNA
vQfV+zUXFEBxPLIj+JPFP3/kToe/tta/On2Q3684DUBBWIM88xvhP7nXCYaM
kgLAqC1519qHE0BoGjZlqNTbPydVyVr8P/u/92bmMqioEsCvUX65xI2QP3fx
iUOJruC/v3VOdETo9j+kFWFLwt7jP35z0E9NMfg/LIR/Fmo99z9cLZG0zAry
v/Md8IlRM/I/1h4eJlil+D9u6TAqxFnbP+RDURC9yP+/FIF+xlkjAMCpiHQe
0XLLPxOpiqBeLPS/YHTiQccPyr/DE8A8SKzfv7Mp7UBGwANALm9d9rPdEcDU
xtGBxzngv8b1bRic9gBAq5m0sed+A8AEV5jB6g/ov4cFanjxVwxAiTcUVkUM
GECIia1bLui4P1A2VSIl8bg/sQjgpOd3DEDDSy9oPtPnP7GHkCSyDwvAw4Dt
HDP/FkDYuDfKtpriP4RZOcfo1QLAAPTQ+IgsEsB4GycdsMbtv9MjviBrxALA
TtrRF4OHGMDIuo3zyCL3PxqSF3Cq/uK/TTFwIA==
"], "Angstroms", {{1}, {
         2}}}]], AtomDiagramCoordinates -> CompressedData["
1:eJxTTMoPSmViYGCQA2IQrbihKGPiWzaHN4E75FpfP9zv+7kvuCRFCM6f/Ux2
+YsTMg6tr0EC7A5x3ifYbW+LwvlVZqvtwm/zOlSLrHN/WMVwAKb/m0ZM/6Gv
P/bD1INMC9yxbj/MPpg8qn6OAzD1oiCuyDv7vMWMe1iDJB24ri8usOX6Duej
uw+mHsaH2ccAAXD3weyH8HkOoMpzHICZD/Efs0PU1523umyFHe64MVdwqzAe
yNj8qnjrVRGH6I3738yz+b7/V13WnhJhQah/uA4sTAcpEHaAGPsF7l6g44AW
fNofecroyMZ3cnB5GB/s/HXX9/MWrum+nfHdHiL/Bx5eEP8IHIDJw+yD+Rfq
H3j8wPgAajjYEg==
"]}], 
   Molecule[{
    "F", "F", "O", "O", "O", "C", "C", "C", "C", "C", "C", "C", "B", 
     "H", "H", "H", "H", "H", "H", "H"}, {
Bond[{1, 8}, "Single"], 
Bond[{2, 9}, "Single"], 
Bond[{3, 7}, "Single"], 
Bond[{3, 12}, "Single"], 
Bond[{4, 13}, "Single"], 
Bond[{4, 19}, "Single"], 
Bond[{5, 13}, "Single"], 
Bond[{5, 20}, "Single"], 
Bond[{6, 8}, "Aromatic"], 
Bond[{6, 9}, "Aromatic"], 
Bond[{6, 13}, "Single"], 
Bond[{7, 10}, "Aromatic"], 
Bond[{7, 11}, "Aromatic"], 
Bond[{8, 10}, "Aromatic"], 
Bond[{9, 11}, "Aromatic"], 
Bond[{10, 14}, "Single"], 
Bond[{11, 15}, "Single"], 
Bond[{12, 16}, "Single"], 
Bond[{12, 17}, "Single"], 
Bond[{12, 18}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{20, 3}, {CompressedData["
1:eJwB8QEO/iFib1JlAgAAABQAAAADAAAAA9whD+HN/D8TkidwwanuPxbdar+C
mwHAPF4+Bt4k8T81Ks246+rsv03jE+VcGgFAVeproLc+BcBrkzwzgILQP2Nw
9a+gYua/p+Ok4cslDkBQlF+syeHqv2N/3bpIhue/myrJSs2oDEAar/X6PI/m
P2Fw4K1ywvQ/Z9gcXcvw9j8lB5j0SK6ZP+mrEeSeH5u/u7ZftP3o9L/sqBmB
3MLEP7BI6vCauNu/rijPwfO47j/ms2vZML7gP/GImF+KVPO/sz7UQbeB4j/c
pyAbGvHZv76OFRcmkO4/3qX+Rl4q2r9EvKlYZqLiP00S2M19Ova/aJZFBEcH
6b/FlpuiWEnVv42z2KDBwOc/QzP+UZliDcCf1k/Cg6fAv2NZlpJPwcY/RCUQ
oiG9B0BJxnrgwc2ov825xD14xcg/nnMxaLgF6b/MLDNLoj7vP9LHhtSBlwLA
eq6ZUAWH97+MZSSeR13lv5UB+43qFvg/lbotBw3ZDMD/5rE6aKfzv7FtjuOH
NdQ/RtL6yQCOEsDzNeOrgSTHPz8jYMtvitG/0TKluVDwDMDs7MWq08TXP/uO
l7YTo/I/Y1+88vtGDUBxVIPF6pH8v3ULuTqGl9+/vwNLshb0CEASI3Xjtpb5
P4ebjTjPtPQ/8MoI9A==
"], "Angstroms", {{1}, {2}}}]], 
     AtomDiagramCoordinates -> CompressedData["
1:eJxTTMoPSmViYGAQAWIQDQUOouvcH1aJPLOP8z7BbntbFM6vMlttF36b16Fa
BCTAdMD3c19wSYqQQ+vrwB1yrYwOihuKMia+ZYPzYerR9X/TiOk/9PXLfpj6
IKDq14En7GHmwfgw+Tcg416/3A+Th/Fh8hD3sB2Amc91fXGBLddv++UvPPT+
L2SCqv+4HyzeJQLnL5t9RGFDEYsDo28Lr78+0wGYeoj7OA7MAUlncDp8vX29
sfgYF9y/UPsc0Ox3AABVk5HT
"]}], 
   Molecule[{
    "O", "O", "C", "C", "C", "C", "C", "C", "C", "C", "B", "H", "H", 
     "H", "H", "H", "H", "H", "H", "H", "H", "H", "H", "H", "H", 
     "H"}, {
Bond[{11, 10}, "Single"], 
Bond[{10, 9}, "Double"], 
Bond[{9, 3}, "Single"], 
Bond[{3, 4}, "Single"], 
Bond[{4, 6}, "Single"], 
Bond[{6, 8}, "Single"], 
Bond[{8, 7}, "Single"], 
Bond[{7, 5}, "Single"], 
Bond[{11, 1}, "Single"], 
Bond[{11, 2}, "Single"], 
Bond[{5, 3}, "Single"], 
Bond[{10, 24}, "Single"], 
Bond[{9, 23}, "Single"], 
Bond[{3, 12}, "Single"], 
Bond[{4, 13}, "Single"], 
Bond[{4, 14}, "Single"], 
Bond[{6, 17}, "Single"], 
Bond[{6, 18}, "Single"], 
Bond[{8, 21}, "Single"], 
Bond[{8, 22}, "Single"], 
Bond[{7, 19}, "Single"], 
Bond[{7, 20}, "Single"], 
Bond[{5, 15}, "Single"], 
Bond[{5, 16}, "Single"], 
Bond[{1, 25}, "Single"], 
Bond[{2, 26}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{26, 3}, {CompressedData["
1:eJwBgQJ+/SFib1JlAgAAABoAAAADAAAAYEc3dGYzEUD5fmkqZ2jvvymVEYQd
sOS/Qsk3iZlnEUBkWNKICGb3P9IRoZWX8/G//xxp45sqs79B6p4hKnXiv4Gp
vulH8NI/pwy6ty928b+LG68T95jwv2FvZJIccOe/zR/o6pH/379phQG+bLXo
P/NXEZ9fkeg/Bk8g0636AsCVv2xXAHXRv/W7gjs8muW/SLatsiA1/L/qPFRc
8RDiPxiDdS6Xufk/3tbEsKezBsCR6Oe1IKSiPza1uurn/eY/wAYAS4zT9D/C
N/jRfHXkv7GWXeNjJsq/jmaa4B/4AEAhge6uOAbZP9XrLSk8p8+/ujdVQ4CP
DEA2EAKPFprRP7p5yikRJem/gIicuS5cyL9nQ795qHz0v8cgVsZxxPI/qah8
mvRO5b8W+pPBJnjtvwwpYglJRvy/ZE2oD7h59L97a5RhYvIAwPD4VGz/qOO/
pRrHCAQqzD8lETqoDX/0P/X/Fyl0ufY/cjYQ/RWL6b+y9//XSxj3PxrWn1CK
z7G/cEqg1Mx8AsAIsUfogc3kP8T0iuWGiPS/894FhSBkCcCqaxO4huzsv5im
u1T+dvK/lRkA7P2d97+agOKZjn3Dv7wpGICVNQNALORFrQj2/7+z3I5rPsz4
P9zrG9MyeABAHGQUXOQHDcDbypiXtU/qPxvPMomPgOQ/pNJQV6KbCsARJyLv
lvvqv75LW3p+APM/p9p0vjHd+j8e00a7NGz5v4MqYYPxC+K/MWE9sct4/D++
WyihjJn1P5utgutFILo/0cLFmcQjEECxWd3t6Xn3vxiTvVELqMQ/6f8orCeE
EEDP7Ba3eHoBQIVNWfrnCN2/Db9O0Q==
"], "Angstroms", {{1}, {2}}}]], 
     AtomDiagramCoordinates -> CompressedData["
1:eJxTTMoPSmViYGCQAmIQ7fu5L7gkRcih9XXgDrlWRgfFDUUZE9+yYfDfgLiv
X+5ngACHbxox/Ye+ftlfZbbaLvw2L5wPk68WWef+sIrpAEwexoeZB+GzwflB
IOMDT9jD1IuCpEWewflc1xcX2HL9tr/smyQQYcntALHmwf447xPstrP/2Kd3
JMfecXu+f/r/CXW/rb7Z9y/4Yfhs3bf91gXnOi7FCTrA+JOtGH1bevkd0NWv
uxFf5j+P8QDMvDtuzBXcKuwHYOphfJh5MPW2IIftZXYQ4N66rNKd64CdzpVZ
z2S54PzlLzz0/i9kgrnX/ldd1p4SYUGof2/Yw8IfGh4OaOHjAADo7bTb
"], 
     StereochemistryElements -> {
Affiliation[
       "StereoType" -> "DoubleBond", "StereoBond" -> {10, 9}, "Value" -> 
        "Opposite", "Ligands" -> {11, 3}]}}], 
   Molecule[{
    "Cl", "O", "O", "O", "C", "C", "C", "C", "C", "C", "C", "C", "C", 
     "C", "C", "C", "C", "C", "C", "B", "H", "H", "H", "H", "H", "H", 
     "H", "H", "H", "H", "H", "H", "H", "H", "H", "H"}, {
Bond[{1, 19}, "Single"], 
Bond[{2, 5}, "Single"], 
Bond[{2, 11}, "Single"], 
Bond[{3, 20}, "Single"], 
Bond[{3, 35}, "Single"], 
Bond[{4, 20}, "Single"], 
Bond[{4, 36}, "Single"], 
Bond[{5, 6}, "Aromatic"], 
Bond[{5, 7}, "Aromatic"], 
Bond[{6, 9}, "Aromatic"], 
Bond[{6, 13}, "Single"], 
Bond[{7, 10}, "Aromatic"], 
Bond[{7, 14}, "Single"], 
Bond[{8, 9}, "Aromatic"], 
Bond[{8, 10}, "Aromatic"], 
Bond[{8, 20}, "Single"], 
Bond[{9, 21}, "Single"], 
Bond[{10, 22}, "Single"], 
Bond[{11, 12}, "Single"], 
Bond[{11, 23}, "Single"], 
Bond[{11, 24}, "Single"], 
Bond[{12, 15}, "Aromatic"], 
Bond[{12, 16}, "Aromatic"], 
Bond[{13, 25}, "Single"], 
Bond[{13, 26}, "Single"], 
Bond[{13, 27}, "Single"], 
Bond[{14, 28}, "Single"], 
Bond[{14, 29}, "Single"], 
Bond[{14, 30}, "Single"], 
Bond[{15, 17}, "Aromatic"], 
Bond[{15, 31}, "Single"], 
Bond[{16, 18}, "Aromatic"], 
Bond[{16, 32}, "Single"], 
Bond[{17, 19}, "Aromatic"], 
Bond[{17, 33}, "Single"], 
Bond[{18, 19}, "Aromatic"], 
Bond[{18, 34}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{36, 3}, {CompressedData["
1:eJwBcQOO/CFib1JlAgAAACQAAAADAAAAoIENDKmGHEDaEmpKLpTrP/rqh8gN
y6i/6jXLlaMc4j/kLUwrGrXHP5rAwVok9MY/nivlnSDXFsAeW0dakP/rP1Gw
JJoGMvo/ZC/gHNOIF8BDA899Jb3vvwodNTY89LK/UCkDmpN56b+KXN59ChHC
P47FWyEllNE/V92ISqaz9b8eTYCMvk3bv9hOyl0VoPY/LFrwxlxB+b9xywsY
6s7kP64ML0afsOe/mkn5CSo2DMCREz2eymSHP3oIrqh4juE/z3Kh1QPKBcAI
VIGxH1Xfv7XCV/uWwfg/Ss2Fw+qOB8CavDeYZzbiP4xk6d3fQ+K/6C6s6QnF
9T/4qX98OZTqvwVUqiSDZdm/I4oEUZdpBkAwthV3gXHcv17SXd/d/dS/Uy/1
26Nc3b/wEmVLofbuvy5uuFAa8ANAsDUlEPe7778Sz4ZWSCX0PyXhjariZP+/
o2LvzrRKDkCXX2dhhSL0v4NOUMjvPeq/TJ1zuNhDCUC4p2HLqlToP643M0g/
Ms8/QPFxYFxmFEBs7g3jPA/rv37opXJRQ+e/5yAfmDPREUDuBr38UbDyPzEF
BOkKfdU/Y/zqu2bZFUDaZNhVqlHXP53Sns1SmsO/CiizmotcFMCxpXoLHGms
v+VamHsWG+Y/8j6M8P1/CcCbFN2xUZTtv4qgRZsqXANATEYCgZ+8DMBevsOo
XoPuP7HE5mnJY/W/qRypCgyZ8T9c765ojJjrv2yUHjdco/e/xZ/O77si9D+H
eB5UULf8v9CAZMbRU70/R2EHWdGN7796NUewrArsv80/RJ5hpwtA7/ej7T0P
xr+kmi+siwkAwNdP/sQ++wFArmZ7oy2m3T8RIfdKq/bUv9I2rPWTLgRA/twz
mWrg+78ks3SVfmz+P3Kg2XMQuQPAcfJ/DZ3dwr+epAbjNC3/P81F1fRxD/u/
HlRkw6en5b93FbSY5unfP+fsogIGqwXAMCV3R4oTDEA9c0P2K64BwIqk2BlT
WvS/KxsV+xLCAkAjAOCmbyX2P4yEW2orB+Q/h55uc+edF0BIhRC1qXT3v5d+
PAeltPG/AXum9yfbEkA8BYrbGegAQLUQR+RfJ+k/DuLFfDmbFcB1uL/V2rr8
P3W4ZmM0wvY/RIVmKTuYGMDoWL0A2kblv7AVa1hr4u6/WHO7nA==
"], 
         "Angstroms", {{1}, {2}}}]], 
     AtomDiagramCoordinates -> CompressedData["
1:eJxTTMoPSmViYGBQAWIQ7fu5L7gkRcjBluv64gJbYYcqs9V24bd5HUA8ruuX
7WHyh79qxPQfEjiguKEoY+JbNjgfpl50nfvDKpFn+2HyYOO4Pu+H6YfxYepb
XwfukGtlhZsH4TMegKlH578BcV+/hLvnG8j6r3/sGSAAbn+c9wl229uicD7M
vmoRkACTA0wexkeV50KT53KA2Qfh8zmgup/3wPIXHnr/FzI5QJzBcgDszy4R
OD/q685bXcBwnabYV1oofdY+Y/Or4q1XRRwUHD8mn4l9aw8Jl9/2/1K/P0lc
+Hk/b+Ga7tsZ3+2DQN4NvLEf5s4dDk2Pjs84vH926PzVayXEHWDqpfXvqrAx
SjjA1IPNnSsCV39ixu5pE/o5HWDhBFMP48PkIeHJA5eH8dHSBzy+YHwAYtH3
eQ==
"]}], 
   Molecule[{
    "F", "F", "F", "O", "O", "O", "C", "C", "C", "C", "C", "C", "C", 
     "C", "C", "B", "H", "H", "H", "H", "H", "H", "H", "H", "H", 
     "H"}, {
Bond[{1, 10}, "Single"], 
Bond[{2, 12}, "Single"], 
Bond[{3, 14}, "Single"], 
Bond[{4, 7}, "Single"], 
Bond[{4, 9}, "Single"], 
Bond[{5, 16}, "Single"], 
Bond[{5, 25}, "Single"], 
Bond[{6, 16}, "Single"], 
Bond[{6, 26}, "Single"], 
Bond[{7, 8}, "Single"], 
Bond[{7, 17}, "Single"], 
Bond[{7, 18}, "Single"], 
Bond[{8, 13}, "Single"], 
Bond[{8, 19}, "Single"], 
Bond[{8, 20}, "Single"], 
Bond[{9, 10}, "Aromatic"], 
Bond[{9, 12}, "Aromatic"], 
Bond[{10, 11}, "Aromatic"], 
Bond[{11, 14}, "Aromatic"], 
Bond[{11, 16}, "Single"], 
Bond[{12, 15}, "Aromatic"], 
Bond[{13, 21}, "Single"], 
Bond[{13, 22}, "Single"], 
Bond[{13, 23}, "Single"], 
Bond[{14, 15}, "Aromatic"], 
Bond[{15, 24}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{26, 3}, {CompressedData["
1:eJwBgQJ+/SFib1JlAgAAABoAAAADAAAA1mdIowCw1D/zrSnJWJfuP3IhpNtC
w/S/8x6Qqn+iwb++92fYFKIHwC8lJoo0svc/3nS+Ib8pDkDk29xOlcfNv/gV
kft+m/k/g+0ujdx487+sJIXFA0b1vzqyeaMhQNe/TO/2YJcYCkAgaQiXLBr7
P+0Kogcvevu/uAABAyUDDUAqawnXILYCQLZdVqzGKOU/YleojMW7A8BS0Y4i
vwnxvwPRLCcikb4/rihh9rXTB8BvI7aUynvUP4MlqrVp1s0/cuggRrP8nz8b
vdM2IwPwv8xSxzgB27Q/Rduu5sEI6D+h8S3X7wm1P2hik4l3+NW/GyGf69M/
AEBeIt9XAhjXP3U22RC+JsU/Xm6RAz0P4j/gpXkBLwr+vyWxKv+I1/A/RSFw
iTgnCcCFTJQrPeXwP1zjr3n7AfG/GTqZmO0xBEDMSCGD7jzgvzHud4Axu/E/
vllK2tHh/D8TeWi9EqX5v2PEGo8cqfg/JxcW5+jEBkDz8SMnmof5P16nVxos
hNS/n17w8damBMC+LrVCck35v9HNyBXnKvI/F0x6YZC8CcCc6Ao8ktH6v8kG
O85zcN+/mxF84ACiAsA21AYqbR3vPx52bagYEOw/MbSxGgrZD8A1vm3HOjnR
P3hqGhcK3+c/OratZRuxEMAXuu8Iiz32P39VY0czz/K/CgaDzCGCA8Ap9qzf
jcT+P0ecfF4amPK/GqhVUmA8B8DMf/6I0uXUPwUDJ5hCKv6/MSmH5fsdAkAw
FUXSORICwL4yBF7XagJAMe7Uh2K5CUDfWpNyXSbqP0kRNEBGdQHA+5O9ggc2
EkCn50rd7cD/P4nIfvPcKeg/z3YxnA==
"], "Angstroms", {{1}, {2}}}]], 
     AtomDiagramCoordinates -> CompressedData["
1:eJxTTMoPSmViYGCQAmIQrbihKGPiWzYHruuLC2y5Ptv7fu4LLkkRcvimEdN/
6Ouf/XmLGfewBknC5WHq3wTukGt9/XJ/nPcJdtvbog6tr0ECrA5VZqvtwm/z
wvkw9TDzGCDAoVpknfvDKqYDMPVg469f3g/ji4KkRZ7B3YPuPpj9qOZxHYC5
B6YfxoeZD9MPcR+jQ1FX35NP8zkc7rgxV3CrMB8INdBaKXyB2yF64/4382x+
Q/w3+4+98ZGNenmLf++f/n9C3W+rb/YeAX8kisOZD0Ds+WYPsx/mnkJbkIv5
D0D8zQJ3n7T+XRU2Rgmoex7Dww8qDw8/GB8ASS20FA==
"]}], 
   Molecule[{
    "O", "O", "O", "C", "C", "C", "C", "C", "C", "C", "C", "C", "C", 
     "B", "H", "H", "H", "H", "H", "H", "H", "H", "H", "H", "H", "H", 
     "H", "H", "H"}, {
Bond[{1, 6}, "Single"], 
Bond[{1, 8}, "Single"], 
Bond[{2, 14}, "Single"], 
Bond[{2, 28}, "Single"], 
Bond[{3, 14}, "Single"], 
Bond[{3, 29}, "Single"], 
Bond[{4, 5}, "Single"], 
Bond[{4, 6}, "Single"], 
Bond[{4, 15}, "Single"], 
Bond[{4, 16}, "Single"], 
Bond[{5, 7}, "Single"], 
Bond[{5, 17}, "Single"], 
Bond[{5, 18}, "Single"], 
Bond[{6, 19}, "Single"], 
Bond[{6, 20}, "Single"], 
Bond[{7, 21}, "Single"], 
Bond[{7, 22}, "Single"], 
Bond[{7, 23}, "Single"], 
Bond[{8, 9}, "Aromatic"], 
Bond[{8, 11}, "Aromatic"], 
Bond[{9, 10}, "Aromatic"], 
Bond[{9, 24}, "Single"], 
Bond[{10, 12}, "Aromatic"], 
Bond[{10, 14}, "Single"], 
Bond[{11, 13}, "Aromatic"], 
Bond[{11, 25}, "Single"], 
Bond[{12, 13}, "Aromatic"], 
Bond[{12, 26}, "Single"], 
Bond[{13, 27}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{29, 3}, {CompressedData["
1:eJwByQI2/SFib1JlAgAAAB0AAAADAAAA7Xa/aSOx5z9bCzIFsdHwv9PY7j7D
PtE/4uSNiZhOE8AtRpnN8/rsP9EU+11s2/K/OmIPuVmWBsBwO/KhONoCQJyf
BfbSVfi/572YiZ0aBkAOEV6eIobqvxjBycm02PC/5elbv8lEDUDuspoM/I7f
vxfi+6vLxrk/EaShT7tZ9T/HYkm4YIzbv/GzKfHsPeu/Gx1LMXqADUCS9ZEk
VNHvP5VvZH0e+tg/iVCsKSSo4r8nLGg6vUjpvwVccGksKOM/rt6A+1qS9b+3
qKHXt5K0P7zXVfnoccS/SGHpUWloBcAKcJtpONDWP6dFs/X8b8M/pKrIFrwV
87+bbMYPrxT2v7GGR+Ds/Po/Nfu4DAe+CcAnkyZi9FbRv564BM6EE/Q/QBiU
wCr6A8CedVZTFmnyv2fmcchKYgBA6Ip7Sq8rDMBVvLIm1Zf1PwHDkkLpRue/
H23eHOMcCUBHebYq+HPQv4gW3Rai9P6/x2Z3+OnqBkDVYJoowWf+v621NYiV
afS/5tb2xFHDEkC+jv9rfwfpvwc/1ik1g8i/zAUkqFhiC0AbhSZjbQTxvwzF
GMEEUvA/HqggW8aq6D/tSSsUEkXpv/EYvLpp7vu/SqHmb0l08z+HsXAOzIXl
P6N5YvGvL+u/11GwuEVAEEAx22Cr0HD4P1bvQeRRQuC/5zDwlulhBUDH8p1S
GZX0P0UxRO08y+U/8wHuhs+yEUABVIUW2WnyPyv8L7BHWPM/M/qjJG9J7b+L
FHZx7U3iPy9qDzTbc/C/SEG7UBpU4r8T8zWf+HkAwD4sX8MqIwJAxfJSkYT9
EMDG2ZFxcVCyvwnbL9/5QPg/aVe6S8uiB8BS8/ZUNy76v+RI0CcsXgdAcbbi
AUo4FcCx8qMBepzfP4xJf6HsiNq/StHlDwcjBsBXKoOn3qwJQI3VRXB27u+/
McBusw==
"], "Angstroms", {{1}, {2}}}]], 
     AtomDiagramCoordinates -> CompressedData["
1:eJxTTMoPSmViYGCQBWIQXWW22i78Nq/Dm8Adcq2vH+7PW8y4hzVI0qH1NUiA
3cH3c19wSYoQnK+4oShj4ls2h2qRde4PqxgOoPI5DsDM+6YR03/o64/9DBAA
lec5ADMPZFvgjnX7YXxRkLTIO/s47xPstrdFHbiuLy6w5foO56O7D6YexoeZ
B1MPcS+zA8camagUa1YH4yMb9fIWf9//Rn+3Oj83k4NHwB+J4nDGA0VdfU8+
zedwuOPGXMGtwnsg1EBrpfAFbod1N+LL/OexH5hsxejb0ssPlWc8YF1wruNS
nKBD9Mb9b+bZfN8P8ReTw6+3rw9YJgsc4C1c030747s9xP98ByD++G0PNIXX
X5/jQInK9P8T7AQcIMHyBe4/oGeABn3a7170k/9luTRcHsYHe3fddbj/oeEJ
jx8YHwBEyMVt
"]}], 
   Molecule[{
    "Cl", "O", "O", "O", "C", "C", "C", "C", "C", "C", "C", "C", "B", 
     "H", "H", "H", "H", "H", "H", "H", "H", "H", "H"}, {
Bond[{1, 11}, "Single"], 
Bond[{2, 5}, "Single"], 
Bond[{2, 9}, "Single"], 
Bond[{3, 13}, "Single"], 
Bond[{3, 22}, "Single"], 
Bond[{4, 13}, "Single"], 
Bond[{4, 23}, "Single"], 
Bond[{5, 6}, "Aromatic"], 
Bond[{5, 7}, "Aromatic"], 
Bond[{6, 8}, "Aromatic"], 
Bond[{6, 13}, "Single"], 
Bond[{7, 10}, "Aromatic"], 
Bond[{7, 14}, "Single"], 
Bond[{8, 11}, "Aromatic"], 
Bond[{8, 15}, "Single"], 
Bond[{9, 12}, "Single"], 
Bond[{9, 16}, "Single"], 
Bond[{9, 17}, "Single"], 
Bond[{10, 11}, "Aromatic"], 
Bond[{10, 18}, "Single"], 
Bond[{12, 19}, "Single"], 
Bond[{12, 20}, "Single"], 
Bond[{12, 21}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{23, 3}, {CompressedData["
1:eJwBOQLG/SFib1JlAgAAABcAAAADAAAAYwlKJ+8KDsCb2HSaKbMEwDUhZuPf
UvO/f0Z7kkOS8T+fkDkJRjrhP0TU4XGh69A/L0KZIcAxAMAS76VwmsEFQNll
HRBTzNC/FD9tyslAAcD8XjTiYlD8P253WxZuPQBANccMhR1EiL/pSK+HWZHL
v6G7CUgxzLa/ta+wFZEy9L9CXrBIjCbTP4wT4yNl9Lk/wN+VfHAytD+1u3x9
j7/3v3etHV81TeS/uTls0xwkA8CVG56SfVzav2OGnBw7+c2/Wfbm/Sv4AkCs
MhAMB0Grv1UW1rqzI6U/q/Go0kSu8L9Ng1ashZIBwHDpHC5HDO+/h+DMqAxr
AsBhFiSQ68T6v3w8DsDE1ui/yP0xcI8FDEA+EelGE77qP/xzAYtVB90/TJKk
Bpsf+L9spP0OObT7P4m0/+ao0+Y/Rv2YOeqQ8T8+yP6BArz9vzAeaISwpOi/
cafZIcoVC8B6qt+RUEl9P8bVdpMRF7S/2vf9kCTCA0AG6pFD42rwvxdCmuTI
sOE/aH9NOp+9A0DwvM0tkFTQvy0EfRXrwPC/BKtnUQsS7r/BZJZtZGAJwFbP
81c3OPa/JcIXNzaQDED3WVurvkvpP0yBsXlwOPk/lFRHOuK/EUAEuYtFAnLZ
P2EExfIRPaM/EyfGrU1KC0AMCExD2fP9P6xMCZcznME/IZkvHt6e9L8VvrGl
GaQIQOlfiTqWeem/xKTm0hZ8A8DxNLKEUY3sPzxQJjfQxQJAjosRyg==
"], 
         "Angstroms", {{1}, {2}}}]], 
     AtomDiagramCoordinates -> CompressedData["
1:eJxTTMoPSmViYGAQB2IQPfuZ7PIXJ2QcqkXWuT+sYjhQZbbaLvw2r8MOudbX
gTvW7c9bzLiHNUjSgev64gJbru/2vp/7gktShDD4bwJBOh7uj/M+wW57WxSu
Hyb/TSOm/9DXH3DzYOoVNxRlTHzLhqEf5h6Yeph+BgiAmw9TLwpSLvLOvkRl
+v8JdgJQ8/7udy/6yf+yXNoBou3CfluQw/cyO8iJZQGd9mG/nc6VWc9kueB8
mHmFYIWsByDuYHL4Nv3u5PbWe/a8hWu6b2d8t4eaZw8Jh9/2l/Lj2c9JPob7
D+p+B5j/YXwAo2Sk1g==
"]}], 
   Molecule[{
    "O", "O", "O", "O", "C", "C", "C", "C", "C", "C", "C", "C", "C", 
     "B", "H", "H", "H", "H", "H", "H", "H", "H", "H", "H", "H"}, {
Bond[{1, 9}, "Single"], 
Bond[{1, 12}, "Single"], 
Bond[{2, 9}, "Double"], 
Bond[{3, 14}, "Single"], 
Bond[{3, 24}, "Single"], 
Bond[{4, 14}, "Single"], 
Bond[{4, 25}, "Single"], 
Bond[{5, 6}, "Aromatic"], 
Bond[{5, 7}, "Aromatic"], 
Bond[{5, 9}, "Single"], 
Bond[{6, 8}, "Aromatic"], 
Bond[{6, 14}, "Single"], 
Bond[{7, 10}, "Aromatic"], 
Bond[{7, 15}, "Single"], 
Bond[{8, 11}, "Aromatic"], 
Bond[{8, 16}, "Single"], 
Bond[{10, 11}, "Aromatic"], 
Bond[{10, 17}, "Single"], 
Bond[{11, 18}, "Single"], 
Bond[{12, 13}, "Single"], 
Bond[{12, 19}, "Single"], 
Bond[{12, 20}, "Single"], 
Bond[{13, 21}, "Single"], 
Bond[{13, 22}, "Single"], 
Bond[{13, 23}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{25, 3}, {CompressedData["
1:eJwBaQKW/SFib1JlAgAAABkAAAADAAAAWk0+EGbL/D+uVl1Hox/wv2RqY3+J
jtE/1pu0ek8f7j8y+scPo8zwP/6lX3G+xOo/8oVuFKEQAcDw9PoF5y0BQAOZ
ZysqRf0//zIJid3C8b/VmDufp7EHQIHzRnorFtK/AYC2U7b14b9DjLO98Nbf
v2PH+0fBsbe/1S0hICAr+r8fu+FGAXfYPxH2cmHHSZO/BeEWnwYN6b8b3Huw
OB/8vzdBVQ2/neO/J2PhDUkqB8D1pMTuOQyaPwfI7vhqsty/avh3cjZZ6D+1
yG1W2VG5v/cghUBbf9c/naE4w+gZAMDKKcgrrQwBwFf4w2GHqvC/5yg7Wqhu
CMAw5osup+/zv5GZImggqe6/gYFJCfn3CED16tnjXJHmv1Vvn/4QV+Y/I6WM
KT7cDEAgRJPkpF/eP3FeloN81ru/+BJ2NrAm978xOw2p5xj9P6f/+w6+5eE/
wXF8Kwzetj8JkdpJtWUDwNHilypU+OS/oKv0N17sDcDJxsbrXjfnP8MlQ2Rg
yti/bPNq9hYfAcDD0Ia5ygUJwOMo0vyAEve/QN0U/RAcEMDqNLru4kr5v4wc
AtK2/fS/f98nvn/ZDUB8r0hTkdH5vw0BCakiPuE/eL8QjlhHCUAKzG8ykFve
v6pNWBArcfw/WnYBSz/NCkC1wrFMs0P2P0hZoKdBUdw/popYrqvlEkD+68Mh
zgbYP0le/dMZsMW/dXhR2TB2CUBzSnZKZjbcP8aXs5TbNfK/uhR83XS6979W
fQlZC8P/P4qiKsMpVARAfp+UwpEe97939McuwBgHQLjnCPCpJfO/eI04tA==

"], "Angstroms", {{1}, {2}}}]], 
     AtomDiagramCoordinates -> CompressedData["
1:eJxTTMoPSmViYGCQBGIQXWW22i78Nq/Dm8Adcq2vH+73/dwXXJIi5CC6zv1h
lcg7+9nPZJe/OCHjwHV9cYEt13f7OO8T7La3RTH4MP15ixn3sAZJOoB4gTvW
7YfJf9OI6T/09cd+mHno9sHUw/RXi4AcwHAAph6mX3FDUcbEt2xw9QwQgGE/
zP0L0ze/Kt4qDJX/uz/ylNGRje/kHCDaLsDVF9qCfMR6ACYPU2+nc2XWM1ku
hzMCx3ft6L1lD1a2lxnOh4TDb/t5DWqH2pZP389buKb7dsZ3e7Dw9df7If5g
cni5fT3z856PcP9D/ecACx8YHwAdLMCt
"]}]};

&#10005

bases = {Molecule[{
Atom["Na", "FormalCharge" -> 1], 
Atom["O", "FormalCharge" -> -1], "H"}, {
Bond[{2, 3}, "Single"]}, {
    AtomDiagramCoordinates -> {{2., 0.25}, {2.866, -0.25}, {3.403, 
      0.06}}}], 
   Molecule[{
    "P", "N", "N", "N", "N", "C", "C", "C", "C", "C", "C", "C", "C", 
     "C", "C", "C", "C", "C", "C", "C", "H", "H", "H", "H", "H", "H", 
     "H", "H", "H", "H", "H", "H", "H", "H", "H", "H", "H", "H", "H", 
     "H", "H", "H", "H", "H", "H", "H", "H", "H", "H", "H", "H", "H", 
     "H"}, {
Bond[{1, 2}, "Single"], 
Bond[{1, 3}, "Single"], 
Bond[{1, 4}, "Single"], 
Bond[{2, 6}, "Single"], 
Bond[{2, 14}, "Single"], 
Bond[{3, 7}, "Single"], 
Bond[{3, 13}, "Single"], 
Bond[{4, 8}, "Single"], 
Bond[{4, 12}, "Single"], 
Bond[{5, 9}, "Single"], 
Bond[{5, 10}, "Single"], 
Bond[{5, 11}, "Single"], 
Bond[{6, 9}, "Single"], 
Bond[{6, 21}, "Single"], 
Bond[{6, 22}, "Single"], 
Bond[{7, 10}, "Single"], 
Bond[{7, 23}, "Single"], 
Bond[{7, 24}, "Single"], 
Bond[{8, 11}, "Single"], 
Bond[{8, 25}, "Single"], 
Bond[{8, 26}, "Single"], 
Bond[{9, 27}, "Single"], 
Bond[{9, 28}, "Single"], 
Bond[{10, 29}, "Single"], 
Bond[{10, 30}, "Single"], 
Bond[{11, 31}, "Single"], 
Bond[{11, 32}, "Single"], 
Bond[{12, 19}, "Single"], 
Bond[{12, 20}, "Single"], 
Bond[{12, 35}, "Single"], 
Bond[{13, 15}, "Single"], 
Bond[{13, 18}, "Single"], 
Bond[{13, 34}, "Single"], 
Bond[{14, 16}, "Single"], 
Bond[{14, 17}, "Single"], 
Bond[{14, 33}, "Single"], 
Bond[{15, 48}, "Single"], 
Bond[{15, 49}, "Single"], 
Bond[{15, 50}, "Single"], 
Bond[{16, 45}, "Single"], 
Bond[{16, 46}, "Single"], 
Bond[{16, 47}, "Single"], 
Bond[{17, 42}, "Single"], 
Bond[{17, 43}, "Single"], 
Bond[{17, 44}, "Single"], 
Bond[{18, 39}, "Single"], 
Bond[{18, 40}, "Single"], 
Bond[{18, 41}, "Single"], 
Bond[{19, 36}, "Single"], 
Bond[{19, 37}, "Single"], 
Bond[{19, 38}, "Single"], 
Bond[{20, 51}, "Single"], 
Bond[{20, 52}, "Single"], 
Bond[{20, 53}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{53, 3}, {CompressedData["
1:eJw9VAlUVGUUng1hWEYkUSpzySUiUREx9/srR1GO4oIQAmVKFEdBSiQWRRFE
TLRUMDc64oKAIiHKlsT9LbCBEFF2NBRIFlFgYIAZmWF6/xvynfOf88579333
u9/33Tdle+AmX5FAIHDgjpg7to4TOpvnv4eCkWs/OHzx25p28DH3WHhHrsIQ
2ymTlP6NOJe/KYPbL4OyLYd6Ydtctzk2aQoMjreSuMseQORqjPhgQS34h4Yn
z3RUg3lH7q/itrKROns4PTBq69m1bnjYs7KgZayEOiWwB2/wqZ8g8KBEiV2d
dOFU5x5cdEf+feHFYRhk5ZYvMYLn04MHdhTsibeqwA3Hz+yyiBaQ0s33Uq+6
9GDexJjOjXn92D6Upni8rhE7Vs/STYkQUbPv0uOe+CmgY4adUfqELjTsGbd6
wz4R1fN4BClhf3286NQA/H1pZU4fVy8/e/fnE6NLYV/F7S39+RJyRPmk9mCQ
EuyLbs3aNVVIEi9PzdfEDuI5VhauBDubtHcqikTUITKXRDUrsC9zw87zIUqQ
Hp3k09VgRD5ibT2rcMg7oHg4SwUeqQ4PFrtoMSE2xrNyiYReCGGIKkgxXjU9
OEpG9fr1It/vSicoYko237M2JPszcrYfqDegTGXbrE7wPLygpjhAiZMfB241
LB9FTiap7FozVJBYNDlzt99rMPb70D/0jYyQq88KZYmdUH79YbW7vwG94Hbx
xs06NUrajlm/NuvDo5lNHaezepDR9VwhpBlOTeFjM7pxIL/hqPaFARn8d9ul
mnkqvMXKTPswWHTe6P2JYqJQOm85vOA+RNNSTrludBKHmkyzzsBjTzgjhVJi
yQP1oV6vfkRZov3lOzo4zeYu6MacQ0xhNa6s6+GQevHTG8s+87KT0mFf1lFA
TbOvcc7UwKwT3GBfiykfo2MaGAx+njgmuQOHq0I5S6VUr1Mb6OfUIfWavFzh
I6acm9qq0BKUFc45Z2OlA/61vZTuWNf3o+uefuA/E755i5/8+73xM1xF1Lj2
yrdLjZuwsvG5SXyakGSxsgI1LH62nkvcEIbxQRKSgDYWtBdQzOOISB6jlyok
UnXSN7df9uPAmX/iY2NMSd3BoFUJAyKyLIw5r8GUC8wgY6Lfj1ZweXTSe9hR
i6+45aNeOoisX8pVakH1x1fXv6wSEl3W3t7MChPqtWJZe316AxzP38m1MCZJ
PzDjpPTpKia8Bmotepc/bDUj+nkkFO4/zT60Tw4LVzrtVq83p+cYHU8dbuIX
RQ5LWOPCMbRayoKixOm8sRpwY+sUaU71+sqRbb17RAPM9H232WN8B6ZFbVzz
S6RkJIdauBnHDNchF26OqJRy4eaAW4Efd7GYcql7NfuuoZ6PRkTKukr+XGEr
I64GV04tErag9WiT7GtqEdH3lxHxJ7Hj6stzcZrz3ujZa1uB97NFQuK0LBgt
b/XJTPA94vP5MJiHz+eSY0b+51lbHDAvMlcBBsU/2YW8HkOcTUUcoga8WSzK
qiGcrbuJBdH/7uTwH1Vmgvs=
"], "Angstroms", {{1}, {2}}}]], 
     AtomDiagramCoordinates -> CompressedData["
1:eJw1Ugkw1FEcXvZv7a51tK0j7SJJKiEVZla9X9ck6VJUqIgdKqwRTVMRKXTo
pox0jGmkFOmQyP/NSipHrqYMYUitI0kpm2N7u/Rm3rz5zXvv+32/7/tm7JZ6
SjQZDMZislXnqtWRCv2cqXCx8qgbHRNDVxlUPH+WogvDmztvZ7xUIO6HrIgl
XB0of2gXnqXxi16xVN6Ue8gUcN91V9vGAdqE8tabXyCApRleN+7d70eSu/5b
PIMNYLzxYLf1Agrevffusy9mwv2/fmHl4z20O09zXlKaCCZwm2kpPwG/DRDA
Mv+uWktfJpRb5EeGXKBAWXB4MH9jGboeZy1LnC0EzinzwH6fdiQ8EuDolW8K
8akrTocGM7DRGfce6jEPkoyaav40aOBRk/0f+INaMBTqHfPg6TjyXJNJEFjw
VZQtd7PTxkUprAEjN+p/DYyJ9X8+RIbJ/D6bD9VVZHlQuCJsUVwhmMH37Fdr
nTkUtv9kxYr3MoaRyv43ZTIKP1LR7DWAWSzCSIcDP89ujrIy5gHPyib2TJEW
lA3Z+J2TjSFxRE1yfesXWpaYvfWtoyZEPzEkEL9p9TwDZjCHvBqy6aet3A8n
2FeZw+urxWnn9WU0EZGd22IE6ms/JrS161zKOSYAsca647ob2PBZIHrTRTOB
FHmXJXL045f79kQXJfJwPkkkxejp8SO1j9LNIKVoH0dxsxOpfV4iBFvJtI5t
xoPIyfWFZ9otDvguVxmrCXcIu5cLDKAlhCGNp8Ym/TYB+UjOj/p1o7Ryxtjv
aAsRZM0sGk2KYmO1v2ILWLlHOnBiDQur+/ibAztX6BMkVtLJJ3waSgKnTOJx
8F/97sK8BAE0TyeDv9fCqY2cEMs+PnzTLXVIn6ukq8Xr6y74KZDLsCzorv8I
muA9jGY2K2L3lvQgU8K6cBMT6BiRS/DKbtReqndtoSUHSohah5zYIOztcDIF
Juip5GDzIFWSHLijZRypZPWwZgH5tEcaMZnHWCZu25ByJZzPnMhBHBc7ejnM
zZnKBdKljtHKxTtJagtGDKFeuku7Jp2Bp6sCsMwQSNg/7jqgjdU25JmA2u5e
Nv4H1Wx/CA==
"]}], Molecule[{
Atom["C", "FormalCharge" -> -1], "C", 
Atom["Li", "FormalCharge" -> 1], "H", "H", "H", "H", "H"}, {
Bond[{1, 2}, "Single"], 
Bond[{1, 4}, "Single"], 
Bond[{1, 5}, "Single"], 
Bond[{2, 6}, "Single"], 
Bond[{2, 7}, "Single"], 
Bond[{2, 8}, "Single"]}, {
    AtomDiagramCoordinates -> {{2.866, 0.}, {3.7321, 0.5}, {
      2., -0.5}, {2.556, 0.5369}, {3.176, -0.5369}, {
      4.0421, -0.0369}, {4.269, 0.81}, {3.4221, 1.0369}}}], 
   Molecule[{
Atom["C", "FormalCharge" -> -1], "C", "C", "C", 
Atom["Li", "FormalCharge" -> 1], "H", "H", "H", "H", "H", "H", "H", 
     "H", "H"}, {
Bond[{1, 2}, "Single"], 
Bond[{1, 3}, "Single"], 
Bond[{1, 6}, "Single"], 
Bond[{2, 4}, "Single"], 
Bond[{2, 7}, "Single"], 
Bond[{2, 8}, "Single"], 
Bond[{3, 9}, "Single"], 
Bond[{3, 10}, "Single"], 
Bond[{3, 11}, "Single"], 
Bond[{4, 12}, "Single"], 
Bond[{4, 13}, "Single"], 
Bond[{4, 14}, "Single"]}, {
    AtomDiagramCoordinates -> {{2.866, -0.25}, {2.866, 0.75}, {
      3.7321, -0.75}, {2., 1.25}, {2.866, -1.25}, {3.403, 0.06}, {
      3.4766, 0.6423000000000001}, {3.0781, 1.3326}, {
      3.4221, -1.2869}, {4.269, -1.06}, {
      4.0421, -0.21310000000000004`}, {2.31, 1.7869}, {1.4631, 
      1.56}, {1.69, 0.7131000000000001}}}], Molecule[{
Atom["K", "FormalCharge" -> 1], 
Atom["O", "FormalCharge" -> -1], "H"}, {
Bond[{2, 3}, "Single"]}, {
    AtomDiagramCoordinates -> {{2., 0.25}, {2.866, -0.25}, {3.403, 
      0.06}}}], Molecule[{
Atom["O", "FormalCharge" -> -1], "C", "C", "C", 
Atom["Li", "FormalCharge" -> 1], "H", "H", "H", "H", "H", "H", "H"}, {
    
Bond[{1, 2}, "Single"], 
Bond[{2, 3}, "Single"], 
Bond[{2, 4}, "Single"], 
Bond[{2, 6}, "Single"], 
Bond[{3, 7}, "Single"], 
Bond[{3, 8}, "Single"], 
Bond[{3, 9}, "Single"], 
Bond[{4, 10}, "Single"], 
Bond[{4, 11}, "Single"], 
Bond[{4, 12}, "Single"]}, {
    AtomDiagramCoordinates -> {{3.7321, 0.75}, {2.866, 0.25}, {2., 
      0.75}, {2.866, -0.75}, {4.5981, 0.25}, {2.866, 0.87}, {2.31, 
      1.2869}, {1.4631, 1.06}, {1.69, 0.21310000000000004`}, {
      2.246, -0.75}, {2.866, -1.37}, {3.486, -0.75}}}], 
   Molecule[{"Ba", "O", "O", "O", 
Atom["C", "MassNumber" -> 13], "H", "H"}, {
Bond[{2, 5}, "Single"], 
Bond[{2, 6}, "Single"], 
Bond[{3, 5}, "Single"], 
Bond[{3, 7}, "Single"], 
Bond[{4, 5}, "Double"]}, {
    AtomDiagramCoordinates -> {{1.153, 3.5}, {2.269, 1.5}, {0.5369, 
      1.5}, {1.4030000000000002`, 0.}, {1.4030000000000002`, 1.}, {
      2.8059, 1.19}, {0., 1.19}}}], Molecule[{
Atom["O", "FormalCharge" -> -1], 
Atom["N", "FormalCharge" -> 1], "C", "C", "C", "C", "H", "H", "H", 
     "H", "H", "H", "H", "H", "H", "H", "H", "H", "H"}, {
Bond[{1, 19}, "Single"], 
Bond[{2, 3}, "Single"], 
Bond[{2, 4}, "Single"], 
Bond[{2, 5}, "Single"], 
Bond[{2, 6}, "Single"], 
Bond[{3, 7}, "Single"], 
Bond[{3, 8}, "Single"], 
Bond[{3, 9}, "Single"], 
Bond[{4, 10}, "Single"], 
Bond[{4, 11}, "Single"], 
Bond[{4, 12}, "Single"], 
Bond[{5, 13}, "Single"], 
Bond[{5, 14}, "Single"], 
Bond[{5, 15}, "Single"], 
Bond[{6, 16}, "Single"], 
Bond[{6, 17}, "Single"], 
Bond[{6, 18}, "Single"]}, {AtomDiagramCoordinates -> CompressedData["
1:eJxTTMoPSmViYGAQBmIQ7WPe6Zjw9I399qT6m7aWwg7LZx9R2FD0zR5Gf/l7
peKlGhNU/J/9c9nlLzz0HtrD9MFoXOpyj/7bVF3E5uCXJBBhuYXR4dMlXyDr
v72vaI/XqxZmh3yh5gOnFrI4OCc8vaB0+6v9G/3d6vzcZ+1naUlMvcL53Z4B
CsDSPx/ZX8qPZz8n+dqevXGqc3fOdbg6mDkwdTB7Yepg9qLbA3MXzB6Yu2D2
wPwDCx8ApKyMBQ==
"]}], Molecule[{
Atom["O", "FormalCharge" -> -1], "O", 
Atom["Li", "FormalCharge" -> 1], "H", "H", "H"}, {
Bond[{1, 4}, "Single"], 
Bond[{2, 5}, "Single"], 
Bond[{2, 6}, "Single"]}, {
    AtomDiagramCoordinates -> {{0.866, 2.5}, {0.7015000000000001, 
      0.}, {0., 3.}, {1.4030000000000002`, 2.81}, {1.2384, 0.31}, {
      0.1645, 0.31}}}], Molecule[{
Atom["Rb", "FormalCharge" -> 1], 
Atom["O", "FormalCharge" -> -1], "O", "H", "H", "H"}, {
Bond[{2, 4}, "Single"], 
Bond[{3, 5}, "Single"], 
Bond[{3, 6}, "Single"]}, {
    AtomDiagramCoordinates -> {{0., 0.5}, {0.866, 0.}, {
      0.7015000000000001, 2.5}, {1.4030000000000002`, 0.31}, {1.2384, 
      2.81}, {0.1645, 2.81}}}], Molecule[{
Atom["O", "FormalCharge" -> -1], 
Atom["N", "FormalCharge" -> 1], "H", "H", "H", "H", "H"}, {
Bond[{1, 7}, "Single"], 
Bond[{2, 3}, "Single"], 
Bond[{2, 4}, "Single"], 
Bond[{2, 5}, "Single"], 
Bond[{2, 6}, "Single"]}, {
    AtomDiagramCoordinates -> {{0.0369, 3.0739}, {0.5369, 0.5369}, {
      1.0739, 0.8469}, {0., 0.2269}, {0.2269, 1.0739}, {0.8469, 0.}, {
      1.0369, 3.0739}}}], Molecule[{
Atom["K", "FormalCharge" -> 1], 
Atom["O", "FormalCharge" -> -1], "C", "C", "C", "C", "H", "H", "H", 
     "H", "H", "H", "H", "H", "H"}, {
Bond[{2, 4}, "Single"], 
Bond[{3, 4}, "Single"], 
Bond[{3, 5}, "Single"], 
Bond[{3, 6}, "Single"], 
Bond[{3, 7}, "Single"], 
Bond[{4, 8}, "Single"], 
Bond[{4, 9}, "Single"], 
Bond[{5, 10}, "Single"], 
Bond[{5, 11}, "Single"], 
Bond[{5, 12}, "Single"], 
Bond[{6, 13}, "Single"], 
Bond[{6, 14}, "Single"], 
Bond[{6, 15}, "Single"]}, {
    AtomDiagramCoordinates -> {{5.4641, 0.75}, {4.5981, 0.25}, {2.866,
       0.25}, {3.7321, 0.75}, {2., 0.75}, {2.866, -0.75}, {2.866, 
      0.87}, {4.1306, 1.225}, {3.3335, 1.225}, {2.31, 1.2869}, {
      1.4631, 1.06}, {1.69, 0.21310000000000004`}, {2.246, -0.75}, {
      2.866, -1.37}, {3.486, -0.75}}}], Molecule[{
Atom["O", "FormalCharge" -> -1], "C", "C", "C", "C", 
Atom["Li", "FormalCharge" -> 1], "H", "H", "H", "H", "H", "H", "H", 
     "H", "H"}, {
Bond[{1, 2}, "Single"], 
Bond[{2, 3}, "Single"], 
Bond[{2, 4}, "Single"], 
Bond[{2, 5}, "Single"], 
Bond[{3, 7}, "Single"], 
Bond[{3, 8}, "Single"], 
Bond[{3, 9}, "Single"], 
Bond[{4, 10}, "Single"], 
Bond[{4, 11}, "Single"], 
Bond[{4, 12}, "Single"], 
Bond[{5, 13}, "Single"], 
Bond[{5, 14}, "Single"], 
Bond[{5, 15}, "Single"]}, {
    AtomDiagramCoordinates -> {{3.7321, 0.5}, {2.866, 0.}, {
      2., -0.5}, {2.366, 0.866}, {3.366, -0.866}, {4.5981, 0.}, {1.69,
       0.0369}, {1.4631, -0.81}, {2.31, -1.0369}, {2.903, 1.176}, {
      2.056, 1.4030000000000002`}, {1.8291, 0.556}, {
      2.8291, -1.176}, {3.676, -1.4030000000000002`}, {
      3.903, -0.556}}}], Molecule[{
Atom["Cl", "FormalCharge" -> -1], 
Atom["Mg", "FormalCharge" -> 2], 
Atom["C", "FormalCharge" -> -1], "C", "C", "C", "H", "H", "H", "H", 
     "H", "H", "H", "H", "H"}, {
Bond[{3, 4}, "Single"], 
Bond[{3, 5}, "Single"], 
Bond[{3, 6}, "Single"], 
Bond[{4, 7}, "Single"], 
Bond[{4, 8}, "Single"], 
Bond[{4, 9}, "Single"], 
Bond[{5, 10}, "Single"], 
Bond[{5, 11}, "Single"], 
Bond[{5, 12}, "Single"], 
Bond[{6, 13}, "Single"], 
Bond[{6, 14}, "Single"], 
Bond[{6, 15}, "Single"]}, {
    AtomDiagramCoordinates -> {{4.5981, 0.}, {3.7321, 0.5}, {2.866, 
      0.}, {2., -0.5}, {2.366, 0.866}, {3.366, -0.866}, {1.69, 
      0.0369}, {1.4631, -0.81}, {2.31, -1.0369}, {2.903, 1.176}, {
      2.056, 1.4030000000000002`}, {1.8291, 0.556}, {
      2.8291, -1.176}, {3.676, -1.4030000000000002`}, {
      3.903, -0.556}}}], Molecule[{
Atom["Br", "FormalCharge" -> -1], 
Atom["Mg", "FormalCharge" -> 2], 
Atom["C", "FormalCharge" -> -1], "C", "H", "H", "H", "H", "H"}, {
Bond[{3, 4}, "Single"], 
Bond[{3, 5}, "Single"], 
Bond[{3, 6}, "Single"], 
Bond[{4, 7}, "Single"], 
Bond[{4, 8}, "Single"], 
Bond[{4, 9}, "Single"]}, {
    AtomDiagramCoordinates -> {{2., 1.25}, {2.866, 0.75}, {
      2.866, -0.25}, {2.866, -1.25}, {3.403, -0.56}, {3.403, 0.06}, {
      2.246, -1.25}, {2.866, -1.87}, {3.486, -1.25}}}], Molecule[{
Atom["N", "FormalCharge" -> -1], "C", "C", 
Atom["Li", "FormalCharge" -> 1], "H", "H", "H", "H", "H", "H"}, {
Bond[{1, 2}, "Single"], 
Bond[{1, 3}, "Single"], 
Bond[{2, 5}, "Single"], 
Bond[{2, 6}, "Single"], 
Bond[{2, 7}, "Single"], 
Bond[{3, 8}, "Single"], 
Bond[{3, 9}, "Single"], 
Bond[{3, 10}, "Single"]}, {
    AtomDiagramCoordinates -> {{2.866, 0.25}, {3.7321, 0.75}, {
      2.866, -0.75}, {2., 0.75}, {4.0421, 0.21310000000000004`}, {
      4.269, 1.06}, {3.4221, 1.2869}, {2.246, -0.75}, {
      2.866, -1.37}, {3.486, -0.75}}}], Molecule[{
Atom["Ca", "FormalCharge" -> 2], 
Atom["O", "FormalCharge" -> -1], 
Atom["O", "FormalCharge" -> -1], "O", "C"}, {
Bond[{2, 5}, "Single"], 
Bond[{3, 5}, "Single"], 
Bond[{4, 5}, "Double"]}, {
    AtomDiagramCoordinates -> {{0.8536, 2.}, {0.8536, 3.}, {-0.1464, 
      2.}, {-0.8536, 3.7071}, {-0.1464, 3.}}}], 
   Molecule[{"Ni", "Ni", 
Atom["Ni", "FormalCharge" -> 2], "O", "O", "O", "O", 
Atom["O", "FormalCharge" -> -1], 
Atom["O", "FormalCharge" -> -1], "O", "O", "C", "H", "H", "H", "H", 
     "H", "H", "H", "H", "H", "H"}, {
Bond[{4, 13}, "Single"], 
Bond[{4, 14}, "Single"], 
Bond[{5, 15}, "Single"], 
Bond[{5, 16}, "Single"], 
Bond[{6, 17}, "Single"], 
Bond[{6, 18}, "Single"], 
Bond[{7, 19}, "Single"], 
Bond[{7, 20}, "Single"], 
Bond[{8, 12}, "Single"], 
Bond[{9, 12}, "Single"], 
Bond[{10, 12}, "Double"], 
Bond[{11, 21}, "Single"], 
Bond[{11, 22}, "Single"]}, {AtomDiagramCoordinates -> CompressedData["

1:eJxTTMoPSmViYGAQA2IQ7dKd8/z3SkGHxYx7WIWuCDlcX1xgy3X9sX39TdvK
iBU/7S/7JglE7ORz6GP7IOYR8Nu+8FzHpXsKolD1Ig4w/e7MFdwqK3jh+v9v
qv60IeCxve6mue+XH/tuf+DNPBudKwwOMPOkeR/oTljwzP6lmiHHmhhhuPm9
Gm959xmIOTBAgfLtn3VZe97Yy0alWN/vF3KAqYfpNz6yUS/vsbBDwtMLSrd/
ijmsuxFf5h8n5vBcdvkLj3VCDvvmS+nfVRGBu2/i2xp70zg+NPd+hrsXZi+M
b97pCDT6k73VlhNl++RZHSDu+WMvPS9O87TAT/vWmgubI79+swc5z/+ssENF
1VIdZ5nrcD4AUR2Ziw==
"]}], Molecule[{
Atom["Cl", "FormalCharge" -> -1], 
Atom["Mg", "FormalCharge" -> 2], "C", 
Atom["C", "FormalCharge" -> -1], "C", "C", "C", "H", "H", "H", "H", 
     "H", "H", "H", "H", "H", "H", "H"}, {
Bond[{3, 4}, "Single"], 
Bond[{3, 5}, "Single"], 
Bond[{3, 6}, "Single"], 
Bond[{3, 7}, "Single"], 
Bond[{4, 8}, "Single"], 
Bond[{4, 9}, "Single"], 
Bond[{5, 10}, "Single"], 
Bond[{5, 11}, "Single"], 
Bond[{5, 12}, "Single"], 
Bond[{6, 13}, "Single"], 
Bond[{6, 14}, "Single"], 
Bond[{6, 15}, "Single"], 
Bond[{7, 16}, "Single"], 
Bond[{7, 17}, "Single"], 
Bond[{7, 18}, "Single"]}, {
    AtomDiagramCoordinates -> {{2., -0.4145}, {
      2.866, -0.9145000000000001}, {4.5981, 0.0855}, {
      3.7321, -0.4145}, {5.4641, 0.5855}, {
      5.0981, -0.7806000000000001}, {4.0981, 0.9515000000000001}, {
      3.4221, 0.12240000000000001`}, {4.0421, -0.9515000000000001}, {
      5.7741, 0.04850000000000001}, {6.001, 0.8955}, {5.1541, 
      1.1224}, {4.5611, -1.0906}, {
      5.408100000000001, -1.3175000000000001`}, {5.635, -0.4706}, {
      4.635, 1.2615}, {3.7881, 1.4884000000000002`}, {3.5611, 
      0.6415}}}]};

FeatureSpacePlot now has a built-in function extractor for molecules:

&#10005

FeatureSpacePlot[
 Join[Thread[Style[acids, RGBColor[0.8, 0.2, 0.19215686274509805`]]], 
  Thread[
   Style[bases, RGBColor[
    0.2901960784313726, 0.4392156862745098, 0.8901960784313725]]]]]

Chemical Formulation & Chemical Reactions (December 2021)

In Model 12 we launched Molecule as a symbolic illustration of a molecule in chemistry. In successive variations we’ve steadily been including extra capabilities round Molecule. In Model 13.0 we’re including issues like the potential to annotate 2D and 3D molecule plots with further data:

&#10005


&#10005


Molecule supplies a illustration for a selected kind of molecule, with a selected association of atoms in 3D area. In Model 13.0, nevertheless, we’re generalizing to arbitrary chemical formulation, through which one describes the variety of every kind of atom, with out giving data on bonds or 3D association. One can enter a chemical formulation simply as a string:

&#10005


From the formulation alone it’s attainable to compute a number of properties, like molecular mass:

&#10005


Given the chemical formulation, one can ask for particular “identified” molecules which have that formulation:

&#10005


Typically there shall be many such molecules, and for instance one may see how they’re organized in “chemical function area”:

&#10005


Now that we will deal with each molecules and chemical formulation, the following massive step is chemical reactions. And in Model 13.0 the start of that’s the capability to characterize a chemical response symbolically.

You’ll be able to enter a response as a string:

&#10005


Right here’s the response represented by way of specific guidelines:

&#10005


However this isn’t but a balanced response. To stability it, we will use ReactionBalance:

&#10005


And, evidently, ReactionBalance is sort of common, so it may possibly take care of reactions whose balancing requires fixing barely nontrivial Diophantine equations:

&#10005


Biomolecular Sequences: Symbolic DNA, Proteins, and so forth. (December 2020)

There are such a lot of various things in so many areas in Model 12.2 that it’s onerous to know the place to start out. However let’s discuss a totally new space: bio-sequence computation. Sure, we’ve had gene and protein knowledge within the Wolfram Language for greater than a decade. However what’s new in 12.2 is the start of the power to do versatile, common computation with bio sequences. And to do it in a approach that matches in with all of the chemical computation capabilities we’ve been including to the Wolfram Language over the previous few years.

Right here’s how we characterize a DNA sequence (and, sure, this works with very lengthy sequences too):

BioSequence
&#10005

BioSequence["DNA", "CTTTTCGAGATCTCGGCGTCA"]

This interprets the sequence to a peptide (like a “symbolic ribosome”):

BioSequenceTranslate
&#10005

BioSequenceTranslate[%]

Now we will discover out what the corresponding molecule is:

Molecule
&#10005

Molecule[%]

And visualize it in 3D (or compute a lot of properties):

MoleculePlot3D
&#10005

MoleculePlot3D[%]

I’ve to say that I agonized a bit in regards to the “non-universality” of placing the specifics of “our” biology into our core language… nevertheless it positively swayed my pondering that, in fact, all our customers are (for now) definitively eukaryotes. Evidently, although, we’re set as much as take care of different branches of life too:

Entity
&#10005

Entity["GeneticTranslationTable", 
  "AscidianMitochondrial"]["StartCodons"]

You would possibly suppose that dealing with genome sequences is “simply string manipulation”—and certainly our string features are actually set as much as work with bio sequences:

StringReverse
&#10005

StringReverse[BioSequence["DNA", "CTTTTCGAGATCTCGGCGTCA"]]

However there’s additionally numerous biology-specific further performance. Like this finds a complementary base-pair sequence:

BioSequenceComplement
&#10005

BioSequenceComplement[BioSequence["DNA", "CTTTTCGAGATCTCGGCGTCA"]]

Precise, experimental sequences usually have base pairs which can be by some means unsure—and there are normal conventions for representing this (e.g. “S” means C or G; “N” means any base). And now our string patterns additionally perceive issues like this for bio sequences:

StringMatchQ
&#10005

StringMatchQ[BioSequence["DNA", "CTTT"], "STTT"]

And there are new features like BioSequenceInstances for resolving degenerate characters:

BioSequenceInstances
&#10005

BioSequenceInstances[BioSequence["DNA", "STTT"]]

BioSequence can also be utterly built-in with our built-in genome and protein knowledge. Right here’s a gene that we will ask for in pure language “Wolfram|Alpha model”:

BioSequence
&#10005

BioSequence[CloudGet["https://wolfr.am/ROWvGTNr"]]

Now we ask to do sequence alignment between these two genes (on this case, each human—which is, evidently, the default):

BioSequence
&#10005

SequenceAlignment[BioSequence[!(*
NamespaceBox["LinguisticAssistant",
DynamicModuleBox[{Typeset`query$$ = "hba1 gene", Typeset`boxes$$ = 
      TemplateBox[{""hemoglobin, alpha 1"", 
RowBox[{"Entity", "[", 
RowBox[{""Gene"", ",", 
RowBox[{"{", 
RowBox[{""HBA1"", ",", 
RowBox[{"{", 
RowBox[{""Species"", "->", ""HomoSapiens""}], "}"}]}], "}"}]}], 
          "]"}], 
        ""Entity["Gene", {"HBA1", {"Species" -> 
"HomoSapiens"}}]"", ""gene""}, "Entity"], 
      Typeset`allassumptions$$ = {{
       "kind" -> "SubCategory", "phrase" -> "hba1 gene", "template" -> 
        "Assuming ${desc1}. Use ${desc2} as an alternative", "depend" -> "5", 
        "Values" -> {{
          "identify" -> "{HBA1, {Species -> HomoSapiens}}", "desc" -> 
           "HBA1 (human gene)", "enter" -> 
           "*DPClash.GeneE.hba1+gene-_**HBA1.*Species_HomoSapiens---"}
, {"identify" -> "{HbaA1, {Species -> MusMusculus}}", "desc" -> 
           "Hba-a1 (mouse gene)", "enter" -> 
           "*DPClash.GeneE.hba1+gene-_**HbaA1.*Species_MusMusculus---
"}, {"identify" -> "{HbaA2, {Species -> RattusNorvegicus}}", "desc" -> 
           "Hba-a2 (rat gene)", "enter" -> 
           "*DPClash.GeneE.hba1+gene-_**HbaA2.*Species_
RattusNorvegicus---"}, {
          "identify" -> "{HBA1, {Species -> PanTroglodytes}}", "desc" -> 
           "HBA1 (chimpanzee gene)", "enter" -> 
           "*DPClash.GeneE.hba1+gene-_**HBA1.*Species_PanTroglodytes--
-"}, {"identify" -> "{HBA1, {Species -> GallusGallus}}", "desc" -> 
           "HBA1 (rooster gene)", "enter" -> 
           "*DPClash.GeneE.hba1+gene-_**HBA1.*Species_GallusGallus---
"}}}}, Typeset`assumptions$$ = {}, Typeset`open$$ = {1, 2}, 
      Typeset`querystate$$ = {
      "On-line" -> True, "Allowed" -> True, "mparse.jsp" -> 
       0.773582`6.3400513493594115, "Messages" -> {}}}, 
DynamicBox[ToBoxes[
AlphaIntegration`LinguisticAssistantBoxes["", 4, Automatic, 
Dynamic[Typeset`query$$], 
Dynamic[Typeset`boxes$$], 
Dynamic[Typeset`allassumptions$$], 
Dynamic[Typeset`assumptions$$], 
Dynamic[Typeset`open$$], 
Dynamic[Typeset`querystate$$]], StandardForm],
ImageSizeCache->{223., {7., 15.}},
TrackedSymbols:>{
        Typeset`question$$, Typeset`containers$$, Typeset`allassumptions$$, 
         Typeset`assumptions$$, Typeset`open$$, Typeset`querystate$$}],
DynamicModuleValues:>{},
UndoTrackedVariables:>{Typeset`open$$}],
BaseStyle->{"Deploy"},
DeleteWithContents->True,
Editable->False,
SelectWithContents->True])], BioSequence[!(*
NamespaceBox["LinguisticAssistant",
DynamicModuleBox[{Typeset`query$$ = "hba2 gene", Typeset`boxes$$ = 
      TemplateBox[{""hemoglobin, alpha 2"", 
RowBox[{"Entity", "[", 
RowBox[{""Gene"", ",", 
RowBox[{"{", 
RowBox[{""HBA2"", ",", 
RowBox[{"{", 
RowBox[{""Species"", "->", ""HomoSapiens""}], "}"}]}], "}"}]}], 
          "]"}], 
        ""Entity["Gene", {"HBA2", {"Species" -> 
"HomoSapiens"}}]"", ""gene""}, "Entity"], 
      Typeset`allassumptions$$ = {{
       "kind" -> "SubCategory", "phrase" -> "hba2 gene", "template" -> 
        "Assuming ${desc1}. Use ${desc2} as an alternative", "depend" -> "5", 
        "Values" -> {{
          "identify" -> "{HBA2, {Species -> HomoSapiens}}", "desc" -> 
           "HBA2 (human gene)", "enter" -> 
           "*DPClash.GeneE.hba2+gene-_**HBA2.*Species_HomoSapiens---"}
, {"identify" -> "{HBA, {Species -> BosTaurus}}", "desc" -> 
           "HBA (cow gene)", "enter" -> 
           "*DPClash.GeneE.hba2+gene-_**HBA.*Species_BosTaurus---"}, {
          "identify" -> "{Hbae1, {Species -> DanioRerio}}", "desc" -> 
           "hbae1 (zebrafish gene)", "enter" -> 
           "*DPClash.GeneE.hba2+gene-_**Hbae1.*Species_DanioRerio---"}
, {"identify" -> "{HBA2, {Species -> PanTroglodytes}}", "desc" -> 
           "HBA2 (chimpanzee gene)", "enter" -> 
           "*DPClash.GeneE.hba2+gene-_**HBA2.*Species_PanTroglodytes--
-"}, {"identify" -> "{HBA2, {Species -> GallusGallus}}", "desc" -> 
           "HBA2 (rooster gene)", "enter" -> 
           "*DPClash.GeneE.hba2+gene-_**HBA2.*Species_GallusGallus---
"}}}}, Typeset`assumptions$$ = {}, Typeset`open$$ = {1, 2}, 
      Typeset`querystate$$ = {
      "On-line" -> True, "Allowed" -> True, "mparse.jsp" -> 
       0.754947`6.3294614571576355, "Messages" -> {}}}, 
DynamicBox[ToBoxes[
AlphaIntegration`LinguisticAssistantBoxes["", 4, Automatic, 
Dynamic[Typeset`query$$], 
Dynamic[Typeset`boxes$$], 
Dynamic[Typeset`allassumptions$$], 
Dynamic[Typeset`assumptions$$], 
Dynamic[Typeset`open$$], 
Dynamic[Typeset`querystate$$]], StandardForm],
ImageSizeCache->{223., {7., 15.}},
TrackedSymbols:>{
        Typeset`question$$, Typeset`containers$$, Typeset`allassumptions$$, 
         Typeset`assumptions$$, Typeset`open$$, Typeset`querystate$$}],
DynamicModuleValues:>{},
UndoTrackedVariables:>{Typeset`open$$}],
BaseStyle->{"Deploy"},
DeleteWithContents->True,
Editable->False,
SelectWithContents->True])]]

What’s in 12.2 is de facto just the start of what we’re planning for bio-sequence computation. However already you are able to do very versatile issues with massive datasets. And, for instance, it’s now easy for me to learn my genome in from FASTA recordsdata and begin exploring it…

BioSequence
&#10005

BioSequence["DNA", 
 First[Import["Genome/Consensus/c1.fa.consensus.fa"]]]

Bio Sequences: Plots, Secondary Bonds and Extra (December 2021)

In Model 12.2 we launched the idea of BioSequence, to characterize molecules like DNA, RNA and proteins that encompass sequences of discrete models. In Model 13.0 we’re including a wide range of new BioSequence capabilities. One is BioSequencePlot, which supplies a right away visible illustration of bio sequences:

&#10005


However past visualization, Model 13.0 additionally provides the power to characterize secondary construction in RNA, proteins and single-stranded DNA. Right here, for instance, is a chunk of RNA with further hydrogen bonds:

&#10005


It’s also possible to specify secondary construction utilizing “dot-bracket” notation:

&#10005


BioSequence additionally helps hybrid strands, involving for instance linking between DNA and RNA:

&#10005


Molecule converts BioSequence to an specific assortment of atoms:

&#10005


Placing all of it collectively, right here’s an instance of crosslinking between two peptides (now with disulfide bonds), on this case for insulin:

&#10005


div.bottomstripe {
max-width:620px;
margin-bottom:10px;
background-color: #fff39a;
border: strong 2px #ffd400;
padding: 7px 10px 7px 10px;
line-height: 1.2;}
div.bottomstripe a,
#weblog .post_content .bottomstripe a:hyperlink,
#weblog .post_content .bottomstripe a:visited {
font-family:”Supply Sans Professional”,Arial,Sans Serif;
font-size:11pt;
shade:#aa0d00;}
div.bottomstripe.purple {
background-color: #f7f2ff;
border: strong 2px #e4d9f4;}
div.bottomstripe.purple a,
#weblog .post_content .bottomstripe.purple a:hyperlink,
#weblog .post_content .bottomstripe.purple a:visited {
shade:#531368;}

RELATED ARTICLES

LEAVE A REPLY

Please enter your comment!
Please enter your name here

Most Popular

Recent Comments